|
|
Home | Alpha Telephone | Domain Names | Web Hosting | Get Traffic | xrEvidence | xrSoccer United States Patent
Compositions and methods for administering Borrelia DNA Plasmid DNA encoding at least one Borrelia genospecies antigen and methods for making and using such a plasmid are disclosed and claimed. The genospecies can be burgdorferi, garinii and/or afzelli. The antigen can be OspA and/or OspB and/or OspC. Compositions containing the plasmid DNA are useful for administration to a host susceptible to Lyme Disease for an in vivo response, such as a protective response, or for generating useful antibodies. The inventive plasmid can also be transfected into cells for generating antigens in vitro. And, the inventive plasmid can be prepared by isolating DNA (such as DNA coding for: promoter, leader sequence, antigen, and terminator) and performing a ligation or ligations, such as a three-way ligation. More particularly, administration of DNA encoding Borrelia genospecies antigen, e.g., OspA and/or OspB and/or OspC and compositions therefor for eliciting an immunological response against Borrelia, such as a protective response preventive of Lyme Disease, are disclosed and claimed. Thus, Lyme Disease vaccines or immunological compositions, and methods of making and using them, are disclosed and claimed.
Primary Examiner: Low; Christopher S. F. Assistant Examiner: Nguyen; Dave Trong Attorney, Agent or Firm: What is claimed is: 1. A plasmid for expression of a Borrelia protein antigen wherein the Borrelia is selected from the group consisting of Borrelia burgdorferi, Borrelia garinii and Borrelia afzelli and the protein antigen is selected from the group consisting of OspA and OspB, said plasmid comprising DNA encoding the Borrelia protein antigen operatively linked to regulatory sequences which control expression and secretion of the Borrelia protein antigen from a mammalian cell. 2. The plasmid of claim 1 comprising from upstream to downstream: DNA encoding a promoter for driving expression in a eukaryotic cell, DNA encoding a eukaryotic leader peptide for facilitating secretion of a prokaryotic protein sequence from a mammalian cell, DNA encoding the Borrelia protein antigen, and DNA encoding a terminator. 3. The plasmid of claim 2 wherein the promoter is a mammalian virus promoter. 4. The plasmid of claim 3 wherein the promoter is a herpes virus promoter. 5. The plasmid of claim 4 wherein the promoter is a human cytomegalovirus promoter. 6. The plasmid of claim 5 wherein the DNA encoding a leader peptide is from DNA encoding human tissue plasminogen activator. 7. The plasmid of claim 6 wherein the DNA encoding a terminator is the 3' UTR transcriptional terminator from the gene encoding Bovine Growth Hormone. 8. The plasmid of claim 1 wherein the Borrelia protein antigen comprises an antigen from Borrelia burgdorferi. 9. The plasmid of claim 8, wherein the antigen is OspA thereof. 10. An immunological composition comprising a plasmid as claimed in claim 1 and a carrier or diluent. 11. An immunological composition comprising a plasmid as claimed in claim 8 and a carrier or diluent. 12. An immunological composition comprising a plasmid as claimed in claim 9 and a carrier or diluent. 13. A method for eliciting an immunological response in a host comprising intramuscularly administering to the host the composition as claim in claim 10, 11, or 12 wherein the Borrelia antigen is expressed, and wherein an immunological response in the host is elicited by the Borrelia antigen. 14. A method for expressing a Borrelia protein antigen in vitro comprising transfecting a eukaryotic cell with a plasmid as claimed in claim 1. 15. A method for expressing a Borrelia protein antigen in vitro comprising transfecting a eukaryotic cell with a plasmid as claimed in claim 1. 16. The method of claim 15 wherein the Borrelia protein antigen comprises OspA. 17. The method of claim 13 wherein the method is for eliciting a protective immunological response in the host against a Borrelia burgdorferi infection and the plasmid comprises DNA encoding an immunologically active OspA protein antigen of Borrelia burgdorferi which elicits a protective immunological response in the host. 18. The method of claim 17, wherein the Borrelia burgdorferi is Borrelia burgdorferi sensu stricto. RELATED APPLICATIONS Reference is made to U.S. or PCT applications Ser. Nos. 08/320,416, filed Oct. 3, 1994 (allowed), 08/137,175, filed Oct. 26, 1993 (allowed), 08/262,220, filed Jun. 20, 1994, PCT/US95/07665, 08/373,455, filed Jan. 17, 1995(abandoned), PCT/US92/08697, WO 90/04411, 08/470,672, filed Jun. 6, 1995 and 08/479,017 filed Jun. 6, 1995, each of which is hereby incorporated herein by reference. Several documents are cited in this application, with full citation thereof where cited, or in the listing headed "References" before the claims; and, each document cited herein is hereby incorporated herein by reference. FIELD OF THE INVENTION This invention relates to compositions and methods for administering Borrelia genospecies DNA encoding antigen(s) in vivo or in vitro. More particularly, this invention relates to compositions and methods for administering Borrelia genospecies DNA encoding an antigen or antigens, e.g., OspA (outer surface protein A) and/or OspB (outer surface protein B), and/or OspC (outer surface protein C), or fragments thereof, for expression thereof, in vivo, ex vivo or in vitro. BACKGROUND OF THE INVENTION Lyme disease is a multisystem illness, transmitted by ticks of the Ixodes ricinus complex. The spirochaete Borrelia burgdorferi sensu lato is the etiologic agent of Lyme disease, which is now the most common arthropod borne disease in the United States, and is endemic in Central Europe (Barbour and Fish 1993). More particularly, there are three genospecies of Borrelia associated with Lyme disease: Borrelia burgdorferi, Borrelia afzelli and Borrelia garinii. Borrelia burgdorferi is the etiologic agent of Lyme disease in North America, and some European Lyme disease is considered to be Borrelia burgdorferi sensu stricto. Borrelia afzelli and Borrelia garinii are the major cause of European Lyme disease and are considered Borrelia burgdorferi sensu lato. Although Lyme disease is curable by antibiotic therapy in its early stages, if Lyme disease is allowed to progress, cardiac, neurological and joint abnormalities can arise. Investigations into the development of a human vaccine for Lyme disease are under way. The outer surface lipoprotein OspA of Borrelia burgdorferi is the current major candidate molecule for development of such a vaccine. Recombinant OspA lipoprotein (rOspA) is known to elicit a protective immune response in mice against challenge by infectious B. burgdorferi (Fikrig et al., 1990; Erdile et al., 1993; U.S. Ser. No. 08/373,455). OspA is currently undergoing human field trials as a subcutaneously administered vaccine in the United States (Keller et al., 1994). Above-cited applications 08/373,455 and PCT/US92/08697 relate to rOspA vaccines, especially lipidated rOspA, and methods for expressing DNA encoding OspA. Above-cited applications 08/320,416 and WO 90/04411 relate to DNA encoding OspA, the amino acid sequence of OspA, synthetic OspA, compositions containing OspA or synthetic OspA, and methods of using such compositions. And, the other above-cited applications relate to DNA encoding other Borrelia antigens or other Osps, or to DNA encoding useful fragments of OspA or of other Osps, amino acid sequences thereof, compositions containing such fragments or other Osps, and methods for using such compositions; and, such DNA that can be used in the methods of 08/373,455 or PCT/US92/08697 to produce OspA, other Borrelia antigens or outer surface proteins (Osps), or fragments thereof, can be used in this invention. In regard to DNA useful in this invention, reference is also made to Molecular Microbiology (1989), 3(4), 479-486, and PCT publications WO 93/04175, and WO 96/06165. Alternative vaccination strategies are desirable as such provide alternative routes to administration or alternative routes to responses. In particular, it is believed that heretofore the art has not taught or suggested administration to a eukaryotic cell in vitro or ex vivo, or to a mammalian host--domesticated or wild or human--susceptible to Lyme disease, of Borrelia genospecies DNA e.g., DNA encoding OspA and/or OspB, and/or OspC or expression thereof in vivo, especially as herein disclosed. OBJECTS AND SUMMARY OF THE INVENTION It is an object of the invention to provide methods and compositions for administering to a host, such as a mammalian host susceptible to Lyme Disease, Borrelia genospecies isolated and/or purified DNA encoding an antigen or antigens, e.g., isolated and/or purified DNA encoding an antigen or antigens from Borrelia burgdorferi, Borrelia afzelli, Borrelia garinii or combinations thereof, such as isolated and/or purified DNA encoding OspA, and/or OspB and/or OspC; for instance, DNA encoding Borrelia burgdorferi OspA and/or OspB and/or OspC. The compositions can include a carrier or diluent. The DNA is administered in a form to be expressed by the host, and preferably in an amount sufficient to induce a response such as a protective immune response; and, the DNA can be administered without any necessity of adding any immunogenicity-enhancing adjuvant. Accordingly, the present invention provides Borrelia genospecies antigen DNA plasmids for expression by eukaryotic cells, compositions containing the plasmids, and methods for using the compositions and for using the products from the compositions. The plasmid of the invention can comprise from upstream to downstream (5' to 3'): DNA encoding a promoter for driving expression in eukaryotic cells, DNA encoding a leader peptide for enabling secretion of a prokaryotic protein sequence from a mammalian cell, Borrelia genospecies antigen DNA, and DNA encoding a terminator. The DNA encoding a promoter for driving expression in eukaryotic cells can be a eukaryotic, e.g., mammalian, viral promoter, such as a herpes virus promoter. A human cytomegalovirus promoter is presently preferred. The human cytomegalovirus promoter can be an immediate early human cytomegalovirus promoter such as HCMV-IE. The plasmid can contain the HCMV-IE gene 5' untranslated region (UTR) which includes Intron A. This sequence can be 3' to the HCMV-IE promoter and 5' to the portion of the chimeric 5' UTR sequence and leader peptide (the UTR and leader peptide coding sequence can be derived from the DNA encoding the human tissue plasminogen activator, as discussed below). The DNA encoding a leader peptide is for facilitating secretion of a prokaryotic protein sequence from a mammalian cell. This DNA can be any DNA encoding a suitable or similar leader peptide for the purpose of secretion from a mammalian cell, e.g., DNA encoding a eukaryotic leader peptide. For instance, the DNA encoding a leader peptide can be from DNA encoding a peptide hormone, i.e., a peptide hormone leader peptide, such as from a mammal, e.g., a human peptide hormone leader peptide. Specific examples of DNA encoding leader peptides suitable use in the invention include the DNA encoding the leader peptide of insulin (human, bovine, porcine, etc.), renin, Factor VIII, and tissue plasminogen activator. DNA encoding human tissue plasminogen activator (TPA) leader is presently preferred. The DNA encoding TPA is derived from the TPA gene and encodes a portion of the 5' UTR and leader peptide from the gene. TPA DNA having a portion of the 5' UTR and leader peptide can even increase eukaryotic cell expression. Without wishing to necessarily be bound by any one particular theory, increased expression can be due to the 5' UTR. The Borrelia genospecies antigen DNA is preferably without the natural leader sequence. The Borrelia genospecies antigen DNA can preferably encode at least one antigen selected from OspA, OspB, OspC, OspD, other Osps, and other antigens (see applications cited under Related Applications). DNA without the natural leader sequence encoding OspA and/or OspB and/or OspC is presently preferred. The DNA can be from Borrelia burgdorferi, Borrelia afzelli, Borrelia garinii or from any combination thereof; with Borrelia burdorferi presently preferred. The terminator can be any suitable terminator sequence for use in eukaryotic cells; for instance, a terminator sequence from a mamalian peptide hormone. The Bovine Growth Hormone (BGH) terminator is presently preferred. The plasmid of the invention can contain genes for a fusion protein of the activator (e.g., TPA) and the Borrelia antigen (e.g., OspA, OspB, OspC). The invention comprehends compositions comprising the plasmid and a carrier. The carrier can be any suitable carrier which does not disrupt the DNA or the function of the plasmid. Saline is a presently preferred carrier. The invention further comprehends methods of using the compositions, e.g., administering the composition to a host susceptible to Lyme disease to elicit a response or express an antigen. The response can be protective. The response can be simply an antibody response, and the method can further include recovering antibodies and/or antibody-producing cells (with the cells further useful for producing hybridoma cells and monoclonal antibodies, e.g., by fusing the antibody-producing cells to produce hybridoma cells, and then obtaining monoclonal antibodies from expression by the hybridoma cells). The host can be a mammal, such as a human. Still further, the invention provides methods for expressing an antigen or preparing an antigen in vitro comprising transfecting eukaryotic cells with the inventive plasmid. The method can further comprise recovering the antigen from the cells. Methods for preparing the plasmid by ligating the respective pieces of DNA (DNA molecules) from which it is comprised, and methods for using the antibodies and antigens, as well as the antigens and antibodies themselves, are contemplated by the present invention. Other objects and embodiments are disclosed or are obvious from the following Detailed Description. BRIEF DESCRIPTION OF DRAWINGS In the following Detailed Description, reference is made to the accompanying Figures, incorporated herein by reference, wherein: FIG. 1 shows a diagram of VR2210 with a few characteristic restriction sites; FIGS. 2A, 2B, 2C, and 2D show the nucleotide sequence of VR2210 (SEQ ID NO:1) with the location of primer, used to amplify and insert the OspA coding sequence, underlined and overlined; FIG. 3 shows a diagram of VR2211 with a few characteristic restriction sites; FIGS. 4A, 4B, 4C, and 4D show the nucleotide sequence of VR2211 (SEQ ID NO:2) with the location of primer, used to amplify and insect the OspB coding sequence, underlined and overlined; FIGS. 5A, 5B, and 5C show the nucleotide sequence of ospA (TRH43; B. burgdorferi strain 31) (SEQ ID NO:3); FIGS. 6A, 6B, and 6C show the nucleotide sequence of ospB (TRH46; B. burgdorferi strain B31) (SEQ ID NO:4); FIGS. 7A, 7B, 7C, 7D, 7E, 7F, 7G, and 7H show a nucleotide sequence of ospA and ospB (SEQ ID NO:5) and a predicted amino acid sequence therefor (SEQ ID NO:18); FIG. 8 shows a diagram of VR1012; FIG. 9 shows the multiple cloning site sequence of VR1012 from nucleotides 1841 to 2001 (SEQ ID NO:6); FIGS. 10A and 10B show the nucleotide sequence of VR1012 (SEQ ID NO:7); FIGS. 11A and 11B show the nucleotide sequence of nkCMVintBL (SEQ ID NO:8); FIG. 12 shows the nucleotide sequence of the nkCMVintBL cloning site with the TPA signal peptide sequence (SEQ ID NO:9); FIG. 13 shows PCR primers for amplifying ospA (SEQ ID NO:10, 11); FIG. 14 shows PCR primers for amplifying ospB (SEQ ID NO:12, 13); FIG. 15 shows a partial nucleotide sequence of VR2210 (SEQ ID NO:16); FIG. 16 shows a partial nucleotide sequence of VR2211 (SEQ ID NO:17); FIGS. 17, 18A and 18B show immunoblots; and FIG. 19 shows an immunoblot. DETAILED DESCRIPTION Direct injection of plasmid DNA has become a simple and effective method of vaccination against a variety of infectious diseases (see, e.g., Science, 259:1745-49, 1993). It is potentially more potent and longer lasting than recombinant protein vaccination because it elicits both a humoral as well as a cellular immune response. The present invention provides a DNA-based vaccine or immunological composition against Lyme disease (e.g., Borrelia burgdorferi, afzelli, or garinii) and can elicit an immunological response, which can confer protection, even up to 100%, in mice against challenge with an infectious strain of Borrelia burgdorferi. An exemplary plasmid of the invention contains the human cytomegalovirus immediate early promoter driving expression of the B31 outer surface protein A (OspA). To facilitate expression in eukaryotic cells, the natural leader sequence of the gene encoding OspA has been replaced with the human tissue plasminogen activator leader sequence. Expression and secretion was demonstrated in transiently transfected UM449 and BHK cells by Western blot (FIGS. 17, 18A, 18B). Protection was demonstrated in C3H/HeN by injecting, intramuscularly, naked plasmid DNA and subsequently challenging with Sh2 spirochetes. Sera taken following vaccination contained high titers of antibody to OspA which inhibited spirochete growth in vitro. Immunized animals showed no sign of Lyme disease at 14 days after challenge. Moreover, all tissues examined were completely free of spirochetes. Thus, a DNA vaccine or immunological composition, expressing a Borrelia antigen, for instance a Borrelia burgdorferi, Borrelia afzelli, Borrelia garini antigen or combinations thereof, e.g., OspA, OspB, OspC protein or any combination thereof, can protect mice against infection by a Borrelia genospecies, the etiologic agent of Lyme disease. The composition is thus useful for eliciting a protective response in a host susceptible to Lyme Disease, as well as for eliciting antigens and antibodies, which also are useful in and of themselves. Therefore, as discussed above, the invention in a general sense preferably provides methods for immunizing, or vaccinating, or eliciting an immunological response in a host, such as a host susceptible to Lyme disease, e.g., a mammalian host, against Borrelia and accordingly Lyme Disease, by administering DNA encoding a Borrelia antigen, for instance DNA encoding a Borrelia burgdorferi, Borrelia afzelli, Borrelia garinii antigen or combinations thereof, e.g., OspA and/or OspB, and/or OspC, preferably OspA, in a suitable carrier or diluent, such as saline; and, the invention provides plasmids and compositions for performing the method, as well as methods for making the plasmids, and uses for the expression products of the plasmids, as well as for antibodies elicited thereby. From present dog and human trials based on efficacy studies with mice (Erdile et al., 1993; U.S. Ser. No. 08/373,455), it is clear that mice are now a suitable animal model with respect to Borrelia and Lyme disease for extrapolation to domestic animals, humans, and other animals susceptible to Lyme disease or Borrelia infection (e.g., wild animals such as deer). In view of the broad nature of the invention, i.e., that the invention is applicable to Borrelia genospecies other than burgdorferi (i.e., the invention is also applicable to genospecies afzelli and garinii, and broadly to any Borrelia genospecies antigen or antigens and immunologically active fragments thereof), discussion herein directed to OspA is intended toward the broad nature of the invention, i.e., "OspA" is exemplary and can be read in this specification to include any Borrelia genospecies antigen or an immunological fragment thereof. In the present invention, the DNA encoding OspA, or broadly, the Borrelia genospecies antigen or immunologically active fragment thereof, can be administered in dosages and by techniques well known to those skilled in the medical or veterinary arts taking into consideration such factors as the age, sex, weight, species and condition of the particular patient, and the route of administration. DNA encoding OspA, or broadly the Borrelia genospecies antigen or immunologically active fragment thereof, can be administered alone, or can be co-administered or sequentially administered with other Borrelia antigens, or with DNA encoding other Borrelia genospecies antigens; and, the DNA encoding OspA or broadly the Borrelia genospecies antigen or immunologically active fragment thereof, can be sequentially administered, e.g., each Spring as the "Lyme Disease season" is about to begin. As broadly discussed above, the invention comprehends plasmids comprising DNA including Borrelia genospecies antigen DNA for expression by eukaryotic cells. The DNA, from upstream to downstream (5' to 3'), can comprise: DNA encoding a promoter for driving expression in eukaryotic cells, DNA encoding a leader peptide which enables secretion of a prokaryotic protein sequence from a mammalian cell, DNA encoding a Borrelia genospecies antigen (or antigens), and DNA encoding a terminator. For instance, the promoter can be a eukaryotic viral promoter such as a herpes virus promoter, e.g., human cytomegalovirus promoter DNA. The DNA encoding a leader peptide which enables secretion of a prokaryotic protein sequence from a mammalian cell is any DNA encoding any suitable leader for this purpose such as DNA encoding a eukaryotic, preferably mammalian, leader sequence; for instance, DNA encoding a leader peptide of a peptide hormone, or, for example, of insulin, renin, Factor VIII, TPA, and the like, with DNA encoding human tissue plasminogen activator (TPA) leader peptide presently preferred. The human cytomegalovirus promoter can be an immediate early human cytomegalovirus promoteer such as HCMV-IE. As to HCMV promoter, reference is made to U.S. Pat. Nos. 5,168,062 and 5,385,839. The plasmid of the invention can contain the HCMV-IE gene 5' untranslated region (UTR) which includes Intron A. This sequence can be 3' to the HCMV-IE promoter and 5' to the activator portion of the 5' UTR sequence and leader peptide. The TPA sequence can be derived from the TPA gene and can encode a portion of the 5' UTR and leader peptide from that gene. The 5' UTR of TPA may increase eukaryotic cell expression. The Borrelia genospecies DNA can be from B. burgdorferi, afzelli, garinii or combinations thereof, e.g., B. burgdorferi; and, can encode an antigen such as OspA, OspB, OspC, OspD, other outer surface proteins or a combination of antigens, e.g., OspA and/or OspB and/or OspC; preferably without the natural leader sequence. The transcriptional terminator sequence can be any suitable terminator, such as a eukaryotic terminator, for instance, DNA encoding a terminator for a mammalian peptide, with the BGH terminator presently preferred. The plasmid can be in admixture with any suitable carrier, diluent or excipient such as sterile water, physiological saline, and the like. Of course, the carrier, diluent or excipient should not disrupt or damage the plasmid DNA. The plasmid can be administered in any suitable manner. The plasmid can be in a composition suitable for the manner of administration. The compositions can include: liquid preparations for orifice, e.g., oral, nasal, anal, vaginal, peroral, intragastric administration and the like, such as solutions, suspensions, syrups, elixirs; and liquid preparations for parenteral, subcutaneous, intradermal, intramuscular, intravenous administration, and the like, such as sterile solutions, suspensions or emulsions, e.g., for administration by injection. Intramuscular administration and compositions therefor are presently preferred. The plasmids of the invention can be used for in vitro expression of antigens by eukaryotic cells. Recovery of such antigens can be by any suitable techniques; for instance, techniques analogous to the recovery techniques employed in the documents cited herein (such as the applications cited under Related Applications and the documents cited therein). The thus expressed antigens can be used in immunological, antigenic or vaccine compositions, with or without an immunogenicity-enhancing adjuvant ("expressed antigen compositions"). Such compositions can be administered in dosages and by techniques well known to those skilled in the medical or veterinary arts taking into consideration such factors as age, sex, weight, species, condition of the particular patient, and the route of administration. These compositions can be administered alone or with other compositions, and can be sequentially administered, e.g., each Spring as the "Lyme Disease season" is about to begin. The route of administration for the expressed antigen compositions can be oral, nasal, anal, vaginal, peroral, intragastric, parenteral, subcutaneous, intradermal, intramuscular, intravenous, and the like. The expressed antigen compositions can be solutions, suspensions, emulsions, syrups, elixirs, capsules (including "gelcaps"--gelatin capsule containing a liquid antigen or fragment thereof preparation), tablets, hard-candy-like preparations, and the like. The expressed antigen compositions may contain a suitable carrier, diluent, or excipient such as sterile water, physiological saline, glucose or the like. The compositions can also be lyophilized. The compositions can contain auxiliary substances such as wetting or emulsifying agents, pH buffering agents, adjuvants, gelling or viscosity enhancing additives, preservatives, flavoring agents, colors, and the like, depending upon the route of administration and the preparation desired. Standard texts, such as "REMINGTON'S PHARMACEUTICAL SCIENCE", 17th edition, 1985, incorporated herein by reference, may be consulted to prepare suitable preparations, without undue experimentation. Suitable dosages for plasmid compositions and for expressed antigen compositions can also be based upon the examples below, and upon the documents herein cited. For example, suitable dosages can be 0.5-500 .mu.g antigen, preferably 0.5 to 50 .mu.g antigen, for instance, 1-10 .mu.g antigen in expressed antigen compositions. In plasmid compositions, the dosage should be a sufficient amount of plasmid to elicit a response analogous to the expressed antigen compositions; or expression analogous to dosages in expressed antigen compositions. For instance, suitable quantities of plasmid DNA in plasmid compositions can be 0.1 to 2 mg, preferably 1-10 .mu.g. Thus, in a broad sense, the invention further provides a method comprising administering a composition containing plasmid DNA including DNA encoding a Borrelia genospecies antigen or antigens: for expression of the antigen or antigens in vivo for eliciting an immunological, antigenic or vaccine (protective) response by a eukaryotic cell; or, for ex vivo or in vitro expression (That is, the cell can be a cell of a host susceptible to Lyme Disease, i.e., the administering can be to a host susceptible to Lyme Disease such as a mammal, e.g., a human; or, the cell can be an ex vivo or in vitro cell). The invention further provides a composition containing a Borrelia genospecies antigen or antigens from expression of the plasmid DNA by a eukaryotic cell, in vitro or ex vivo, and methods for administering such compositions to a host mammal susceptible to Lyme disease to elicit a response. Since the methods can stimulate an immune or immunological response, the inventive methods can be used for merely stimulating an immune response (as opposed to also being a protective response) because the resultant antibodies (without protection) are nonetheless useful. From eliciting antibodies, by techniques well-known in the art, monoclonal antibodies can be prepared and, those monoclonal antibodies, can be employed in well known antibody binding assays, diagnostic kits or tests to determine the presence or absence of a Borrelia genospecies or to determine whether an immune response to the bacteria has simply been stimulated. Those monoclonal antibodies can also be employed in recovery or testing procedures, for instance, in immunoadsorption chromatography to recover or isolate a Borrelia genospecies antigen such as OspA, OspB, or OspC. Monoclonal antibodies are immunoglobulins produced by hybridoma cells. A monoclonal antibody reacts with a single antigenic determinant and provides greater specificity than a conventional, serum-derived antibody. Furthermore, screening a large number of monoclonal antibodies makes it possible to select an individual antibody with desired specificity, avidity and isotype. Hybridoma cell lines provide a constant, inexpensive source of chemically identical antibodies and preparations of such antibodies can be easily standardized. Methods for producing monoclonal antibodies are well known to those of ordinary skill in the art, e.g., Koprowski, H. et al., U.S. Pat. No. 4,196,265, issued Apr. 1, 1989, incorporated herein by reference. Uses of monoclonal antibodies are known. One such use is in diagnostic methods, e.g., David, G. and Greene, H. U.S. Pat. No. 4,376,110, issued Mar. 8, 1983; incorporated herein by reference. Monoclonal antibodies have also been used to recover materials by immunoadsorption chromatography, e.g., Milstein, C. 1980, Scientific American 243:66, 70, incorporated herein by reference. To prepare the inventive plasmids, the DNA therein is preferably ligated together to form a plasmid. For instance, the promoter, leader sequence, antigen and terminator DNA is preferably isolated, purified and ligated together in a 5' to 3' upstream to downstream orientation. A three-way ligation, as exemplified below, is presently preferred. Accordingly, the inventive methods and products therefrom have several hereinstated utilities. Other utilities also exist for embodiments of the invention. A better understanding of the present invention and of its many advantages will be had from the following examples given by way of illustration. EXAMPLES Example 1 Plasmid Construction DNA plasmids VR2210 (FIGS. 1 and 2) (SEQ ID NO:1) and VR2211 (FIGS. 3 and 4) (SEQ ID NO:2) containing, respectively, genes coding for OspA (FIG. 5) (SEQ ID NO:3) and OspB (FIG. 6) (SEQ ID NO:4) from Borrelia burgdorferi (see FIG. 7) (SEQ ID NO:5) were constructed by isolating, individually, three DNA molecules: (1) a first DNA molecule having a DNA sequence from restriction endonuclease (PstI and XbaI) digested VR1012 plasmid (FIGS. 8, 9, 10) (SEQ ID NOS:6, 7); (2) a second DNA molecule having a DNA sequence from PCR amplified TPA 5' UTR and leader peptide coding sequence (from nkCMVintBL; see Manthorpe et al. (1993) Human Gene Therapy 4, 419-431; see also Chapman et al. (1991) Nucleic Acids Research 19, 3979-86), PstI and KpnI digested (subsequent to PCR amplification) (FIGS. 11, 12) (SEQ ID NOS:8, 9); and (3) a third DNA molecule having a DNA sequence from PCR amplified Borrelia antigen coding sequence, KpnI and XbaI digested, e.g., PCR amplified DNA encoding OspA (FIG. 5; SEQ ID NO:3) (PCR primers: FIG. 13; SEQ ID NOS:10, 11) or OspB (FIG. 6; SEQ ID NO:5) (PCR primers: FIG. 14; SEQ ID NOS:12, 13) (see also FIG. 7; SEQ ID NO:5; and Howe et al., 1986, Infection and Immunity 54:207-212 ("Howe et al. 1986"); Berstrom et al., 1989, Molecular Microbiology, 3(4), 479-486). The natural leader sequences of the DNA encoding the Borrelia antigen is not present so as to facilitate expression and secretion in mammalian cells. The constructs (VR2210, VR2211) express secreted proteins in vitro and elicit a specific antibody response in vivo. In particular, the construct VR2210 contains DNA encoding OspA and was made by ligating three aforementioned DNA molecules (fragments) together (wherein the third DNA molecule or sequence in the foregoing paragraph is DNA encoding OspA, from a plasmid as in Howe et al. 1986, e.g., pTRH43); and, the construct VR2211 contains DNA encoding OspB and was made by ligating the three aforementioned DNA fragments together (wherein the third DNA molecule or sequence in the foregoing paragraph is DNA encoding OspB from a plasmid as in Howe et al., 1986, e.g., pTRH46). More specifically, the DNA for encoding TPA 5' UTR and leader peptide, ospA and ospB were PCR amplified. The TPA signal was PCR amplified from plasmid nKCMVintBL using the following primers: ##STR1## The ospA gene was PCR amplified from pTRH43 using the primers shown in FIG. 13 (SEQ ID NOS:10, 11) ("Forward" is ospA 5' primer and "Reverse" is ospA 3' primer). The ospB gene was PCR amplified from pTRH46 using the primers shown in FIG. 14 (SEQ ID NOS:12, 13) ("Forward" is ospB 5' primer and "Reverse" is ospB 3' primer). PCR program: 1st--Anneal primer and template 1. 94.degree. C., 2 minutes 2. Ramp slowly, 10 minutes, down to 45.degree. C. 3. 45.degree. C., 5 minutes 2nd--Cycle program 1. 72.degree. C., 3' 2. 93.degree. C., 1' 30" 3. Go to 1 32 cycles 4. 54.degree. C., 2' 30" 5. 72.degree. C. 10' 6. 4.degree. C. 24 hours ______________________________________ PCR REACTIONS BUF- 5' 3' H.sub.2 O FER dNTPs PRIMER PRIMER DNA Taq ______________________________________ 82 uL 10 uL 3 uL TPA-5' TPA-3' .0. 1 uL Taq (25 mM) 2 uL (25 2 uL (25 pico pico mole/uL) mole/mM) 80 uL 10 uL 3 uL 2 uL (25 2 uL (25 2 uL (5 pico 1 uL Taq (25 mM) pico pico mole/uL) mole/uL) mole/mM) 10 uL 3 uL 2 uL (25 2 uL (25 2 uL (5 pico 1 uL Taq (25 mM) pico pico mole/uL) mole/uL) mole/mM) 10 uL 3 uL 2 uL (25 2 uL (25 2 uL (5 pico 1 uL Taq (25 mM) pico pico mole/uL) mole/uL) mole/mM) 82 uL 10 uL 3 uL ospA - 5' ospA - 3' .0. 1 uL Taq (25 mM) 2 uL (25 2 uL (25 pico pico mole/uL) mole/uL) 80 uL 10 uL 3 uL ospA - 5' ospA - 3' 2 uL (5 pico 1 uL Taq (25 mM) 2 uL (25 2 uL (25 mole/uL) pico pico mole/uL) mole/uL) 72 uL 10 uL 3 uL ospA - 5' ospA - 3' 10 uL (1 pico 1 uL Taq (25 mM) 2 uL (25 2 uL (25 mole/uL) pico pico mole/uL) mole/uL) 82 uL 10 uL 3 uL ospB - 5' ospB - 3' .0. 1 uL Taq (25 mM) 2 uL (25 2 uL (25 pico pico mole/uL) mole/uL) 80 uL 10 uL 3 uL ospB - 5' ospB - 3' 2 uL (5 pico 1 uL Taq (25 mM) 2 uL (25 2 uL (25 mole/uL) pico pico mole/uL) mole/uL) 72 uL 10 uL 3 uL ospB - 5' ospB - 3' 10 uL (1 pico 1 uL Taq (25 mM) 2 uL (25 2 uL (25 mole/uL) pico pico mole/uL) mole/uL) ______________________________________ The ospA PCR fragments were digested with KpnI/XbaI as follows: ______________________________________ A. Mixed: 72 uL ospA 10 uL NEB Buffer #1 (New England Biolabs ("NEB") Buffer #1) 10 uL 10x BSA (Bovine serum albumin) 8 uL KpnI (10 ug/uL) (10 units/uL) 100 uL total. ______________________________________ The mixture was allowed to sit for 2 hrs at 37.degree. C. and then subjected to benzene/CHI.sub.3 extraction and spin column (G-50 Sephadex) for purification. ______________________________________ B. Mixed: 100 uL DNA (5 ug) (from A.) 11.5 uL NEB Buffer #2 (New England Biobbs ("NEB") Buffer #2) 1 uL BSA 100x 4 uL XbaI (20 g/uL) (20 units/uL) 115 uL total. ______________________________________ The mixture was allowed to sit for 2 hrs at 37.degree. C. QIAquick (Qiagen) columns were used to purify the fragments (Final volume=50 .mu.L in 10 mM Tris, pH 8.5). The TPA fragments were digested with PstI/KpnI as follows: ______________________________________ A. Mixed: 20 uL TPA (in Tris pH 8.5) 10 uL NEB Buffer #1 1 uL 100x BSA 64 uL TE (10 mM Tris, 1 mM EDTA, pH 8.0) 5 uL KpnI (10 ug/uL) (10 units/uL) 100 uL total. ______________________________________ The mixture was allowed sit for 2 hrs at 37.degree. C. and then subjected to QIAquick DNA spin column; and eluted with 50 .mu.L H.sub.2 O (and then subject to B). ______________________________________ B. Mixed: 50 uL TPA (from A.) 6 uL NEB Buffer #3 (New England Biolabs ("NEB") Buffer #3) 2 uL PstI (10 units/uL) 2 uL TE 60 uL total. ______________________________________ The mixture was let sit 2 hrs at 37.degree. C. Thereafter 40 .mu.L TE was added; and then subjected to phenol/chloroform extraction (1X). After extraction the mixture was subjected to G-50 spin column to purify. The ospB PCR reaction products that were uncut were gel purified by ethanol precipitation, resuspended, loaded on a 1% TBE (Tris-borate) mini-gel and then gel purified using a QIAEX procedure as follows: 1. Excise bands and weigh. 2. Add 3 .mu.L/mg of gel slice. 3. Vortex QIAEX 1' to completely resuspend. 4. Add 10 .mu.L QIAEX for every 5 .mu.g DNA or less Vortex. 5. Incubate at 50.degree. C. for 10' mix every 2 minutes. 6. Centrifuge for 30". 7. Wash 2X in QX2; 500 .mu.L wash. Resuspend by vortexing. Spin 30" full speed. 8. Wash 2X in QX3; 500 .mu.L wash. 9. Remove all traces of supernatant after last wash. 10. Allow to air dry 15 minutes. 11. Elute with 20 .mu.L TE. Resuspend. Incubate 5' at room temperature and spin down QIAEX. Remove supernatant. The ospB fragments were digested with KpnI/BamHI as follows: ______________________________________ A. Mixed: 5uL TE (1.3 ug) 33uL ospB (1/3 ug) 5uL NEB Buffer #1 5uL 10X BSA 2uL KpnI (10 ug/uL) 50 uL total. ______________________________________ The mixture was let sit for 2 hrs at 37.degree. C. Thereafter the mixture was cleaned with Quiaquick and subjected to a spin column. ______________________________________ B. Mixed: 30 uL DNA (1.3 mg; from A.) 4 uL BamHI Buffer (New England Biolabs) 1 uL BamHI (20 ug/uL) (20 units/uL) 5 uL TE 40 uL total. ______________________________________ The mixture was let sit 2 hrs at 37.degree. C. Thereafter the mixture was subjected to a QIAquick column, cleaned and eluted in 30 .mu.L H.sub.2 O. VR1012 was digested with XbaI/PstI as follows: ______________________________________ A. Mixed: 5uL DNA (5 ug) VR1012 3uL 10X BSA 3uL NEB Buffer #2 18 uL TE 1 uL XbaI 30 uL total. ______________________________________ The mixture was let sit for 2 hrs at 37.degree. C. 1 .mu.L was then removed for gel analysis which confirmed digestion. ______________________________________ B. Added to product of A: ______________________________________ 1.5 uL 1M Tris 3.5 uL NaCl (500 mM) 1 uL PstI 35 uL Total ______________________________________ The mixture in B. was let sit for 2 hours at 37.degree. C. Thereafter, 1 .mu.L of EcoRV was added and the resultant mixture incubated at 37.degree. C. for an additional hour (this cuts the small restriction fragment in half and can increase efficiency of removal by the spin column). The mixture was then subjected to a G50 spin column to remove the small insert. To then construct VR2210, a mixture containing 1 .mu.L of the VR1012 digested DNA (25 ng), 1 .mu.L of the digested ospA DNA (200 ng), 6 .mu.L of the digested TPA DNA (50 ng), 2 .mu.L NEB Buffer #2, 10 .mu.L NEB Buffer #1, and 1 .mu.L ligase (Boehringer Mannheim) was prepared. To construct VR2211, a mixture containing 1 .mu.L of the VR1012 digested DNA (25 ng), 5 .mu.L of the digested ospB DNA (150 ng), 3 .mu.L of the digested TPA DNA, 2 .mu.L NEB Buffer #2, 10 .mu.L NEB Buffer #1, and 1 .mu.L of ligase (Boehringer Mannheim) was prepared. Rapid, 3-way ligations occurred in each of the mixtures, with VR2210 and VR2211 resulting, respectively. Control mixtures without (i) the ospA and TPA DNA and (ii) the ospB and TPA were also prepared. The control mixtures were set up to test for the number of background clones due to uncut vector. A very low number (less than one-tenth) of clones were detected as a result of these control ligations clearly indicating that the three-way ligations worked efficiently. FIG. 15 provides a partial sequence of VR2210 extending from a position 5' to PstI site to an arbitrary point 3' to the KpnI site (KpnI, 231) (through the PstI site, the TPA leader, the KpnI site, and into the ospA DNA) (SEQ ID NO: 16). FIG. 16 provides a partial sequence of VR2211 extending from a position 5' to PstI site to an arbitrary point 3' to the KpnI site (KpnI, 266) (through the PstI site, the TPA leader, the KpnI site and into the ospB DNA) (SEQ ID NO: 17). ______________________________________ ANALYTICAL RESTRICTION DIGEST: Enzyme(s) Number and size of fragments ______________________________________ VR2210 1. KpnI 2 fragments: 1042/4804 2. HindIII 2 fragments: 2803/3043 3. PstI 2 fragments: 783/5063 VR2211 1. KpnI 2 fragments: 1091/4803 2. HindIII 2 fragments: 2460/3439 3. PstI 2 fragments: 834/5065 ______________________________________ FIG. 7 provides the nucleotide sequence (SEQ ID NO: 5) of the ospA and ospB genes and the predicted amino acid sequences (SEQ ID NO: 18) of OspA and OspB. Numbers above each line refer to amino acid positions, whereas numbers below the sequence refer to nucleotide positions. The promoter regions P1 and P2 are indicated by horizontal lines. The respective -35 and -10 regions are also shown. The ribosomal binding sites (RBS) are shown by a horizontal line and bold lettering. A possible stem and loop structure at the end of the ospB sequence is indicated by horizontal broken arrows. Start codons of respective OspA and OspB proteins are indicated and stop codons are marked by asterisks. FIG. 7 also shows the location of the KpnI, XbaI and BamHI sites, with arrows indicating direction (first KpnI to XbaI for OspA DNA, second KpnI to BamHI for OspB DNA are also indicated). Example 2 Transfections 5 .mu.g of VR2210 was transfected into both BHK and UM449 human melanoma cells (from Mark Cameron, Univ. Mich.) cells according to the protocol of Felgner et al. (1994), J. Biol. Chem. 269, 2550-2561. The resultant supernatant and cell extract were analyzed for expression of OspA by Western blot, using two anti-OspA antibodies, 3TS at 1:100 dilution and H5332 at 1:10 dilution in 5% milk/BBS (as to the antibodies, reference is made to Barbour, A. G. et al., J. Infect. Dis. 1985, 152, 478-84; Barbour et al., Infect Immun. 1983, 41, 795-804). As the Western blot (FIG. 17) shows, UM449 cells give a higher level of expression of OspA than BHK cells. Also, there is more OspA in the culture supernatant than in the cell lysate. Therefore, the prokaryotic protein is efficiently transported out of the mammalian cells by a eukaryotic signal peptide sequence (TPA). A summary of the results shown in FIG. 17 is provided by the following tabulation. ______________________________________ Gel sup/ DNA DNA/ Amt. lane Sample Cells extract Conc. lipid loaded ______________________________________ 1 VR2211* UM449 extract 5 ug 1/1 40 ul 2 VR2210 UM449 extract 5 ug 1/1 40 ul 3 VR2211 BHK extract 5 ug 1/1 40 ul 4 VR2210 BHK extract 5 ug 1/1 40 ul 5 MW marker 15 ul 6 pos control B31 1 ul lysate 7 VR2211 UM449 sup 5 ug 1/1 20 ul 8 VR2210 UM449 sup 5 ug 1/1 20 ul 9 VR2211 BHK sup 5 ug 1/1 20 ul 10 VR2210 BHK sup 5 ug 1/1 20 ul ______________________________________ *VR2211 is a plasmid containing the OspB gene and is used as a negative control on the Western. This Example also demonstrates that the inventive Borrelia antigen DNA plasmid compositions are additionally useful for in vitro expression of antigen(s) (which by themselves are useful, e.g., for preparing antigenic, immunological or vaccine compositions, or for diagnostic, detection or assay purposes). Example 3 Transfections 5 .mu.g of VR2211 was transfected into UM449 human melanoma cells according to the protocol of Felgner et al. (1994), J. Biol. Chem. 269, 2550-2561. Supernatants and cell extracts were analyzed for expression of OspB by Western blot using a monoclonal anti-OspB called H68 and by a monoclonal anti-OspB called H6831 (as to the antibodies, reference is made to Barbour et al., Infect. Immun. 1984, 45, 94-100) (FIGS. 18A and 18B) with the anti-OspB H68 and H6831 at 1:10 in Blotto. These antibodies detect OspB in both supernatants and cell extracts. The monoclonal anti-OspB designated H6831 binds to spirochete OspB (strain B31) and to unmodified OspB (in vitro translated) but not to modified OspB (i.e., glycosylated and/or phosphorylated by mammalian cellular machinery). Possibly the epitope for H6831 is blocked by eukaryotic post-translational modifications. A summary of the results shown in FIG. 18A is provided by the following tabulation. ______________________________________ sup/ DNA DNA/ Amt. Lane Sample Cells extract Conc. lipid loaded ______________________________________ 1 B31 spirochete lysate 1 ul 2 MW 15 ul markers 3 VR2211 UM449 extract 5 ug 1/1 40 ul clone #16 4 no DNA UM449 extract all 40 ul lipid 5 VR2210 UM449 extract 5 ug 1/1 40 ul 6 VR2211 UM449 extract 5 ug 1/1 40 ul clone #1 7 VR2211 UM449 extract 5 ug 1/1 40 ul clone #2 8 VR2211 UM449 extract 5 ug 1/1 40 ul clone #3 9 VR2211 UM449 extract 5 ug 1/1 40 ul clone #4 10 VR2211 UM449 extract 5 ug 1/1 40 ul clone #5 ______________________________________ A summary of the results shown in FIG. 18B is provided by the following tabulation. ______________________________________ DNA Amt. Lane Sample Cells Supernatant Conc. DNA/lipid loaded ______________________________________ 1 B31 spiro- lysate 1 ul chete 2 MW 15 ul markers 3 VR2211 UM449 sup. 5 ug 1/1 20 ul #16 4 no DNA UM449 sup. all lipid 20 ul 5 VR2210 UM449 sup 5 ug 1/1 20 ul 6 VR2211 UM449 sup. 5 ug 1/1 20 ul #1 7 VR2211 UM449 sup. 5 ug 1/1 20 ul #2 8 VR2211 UM449 sup. 5 ug 1/1 20 ul #3 9 VR2211 UM449 sup. 5 ug 1/1 20 ul #4 10 VR2211 UM449 sup. 5 ug 1/1 20 ul #5 ______________________________________ This Example further demonstrates that the inventive Borrelia antigen DNA plasmid compositions are additionally useful for in vitro expression of antigen(s) (which by themselves are useful, e.g., for preparing antigenic, immunological or vaccine compositions or for diagnostic, detection, or assay purposes). Example 4 Animal Study With VR2210 Two groups of five mice were injected with VR2210 (i.e., ten mice; mice A1-A5, B1-B5), and two groups of five mice (i.e., ten mice) were injected with plasmid VR1020 negative conrol DNA. VR1020 does not contain a coding sequence for a Borrelia antigen. The plasmid and control DNA were diluted in standard saline. Three bilateral injections of DNA were given at two week intervals at a dosage of 50 .mu.g/leg into the rectus femoris muscle. Sera were collected 12 days after each injection and analyzed by 1) Antibody ELISA and 2) Growth Inhibition of Spirochetes. Titers after the first and third injections (Titer #1, Titer #3) are set forth below. Two weeks after the last injection, mice were challenged with 10.sup.4 Sh2 spirochetes (same OspA serogroup as B31) injected intradermally in the tail. Sh2 is a virulent isolate of the same serogroup as B31. Mice were sacrificed 11 days following the challenge. Bladder, heart, plasma, and cross-cuttings of the tibiotarsal joints were cultured for 15 days at 34.degree. C. in growth medium. Cultures were examined for the presence of spirochetes by phase-contrast microscopy and scored as negative if no spirochetes were seen in 50 high-power fields. The antibody ELISA titers for the ten mice administered VR2210 are shown in the following Table. The titers were low after one injection and the group showed considerable variability in their immune response. After the third injection, however, the humoral immune response was uniformly high in 8 out of 10 mice with titers of greater than 1:40,000. ______________________________________ ANTIBODY ELISA TITERS High passage B31 was the antigen used in the ELISA's. Mouse Immunogen Titer #1 Titer #3 ______________________________________ A1 ospA 640 10240 A2 ospA 640 10240 A3 ospA 40 >40,960 A4 ospA 1280 >40,960 A5 ospA 1280 >40,960 B1 ospA <20 >40,960 B2 ospA <20 >40,960 B3 ospA 2560 >40,960 B4 ospA 5120-10,240 >40,960 B5 ospA 1280 >40,960 ______________________________________ No antibody binding to B31 (or immune response to B31) was observed for the mice administered the negative control DNA. The following Table shows the Spirochete Growth Inhibition titers. The numbers indicate the maximal dilution of serum which inhibits spirochete growth in vitro. After the first injection of VR2210, growth inhibition was seen at serum dilutions of 32 to 128. After the third injection, however, inhibition of growth was detected at higher dilutions (up to 512), which is consistent with the antibody titer data. Growth Inhibitory Titers Method: Strain B31 spirochetes were mixed with an 8-fold dilution of serum and two-fold serially diluted in a 96-well plate. Guinea pig complement was added to each well to lyse the spirochetes which have bound antibody. The plates were covered with plastic seals and incubated for 72 hours at 34.degree. C. Growth in each well was determined by observation of the phenol red indicator in the medium from red to yellow as well as by phase-contrast microscopy. The numbers were the maximal dilution of serum which inhibits spirochete growth in the well. ______________________________________ Mouse Immunogen Titer #1 Titer #3 ______________________________________ A1 ospA not 256-512 determined A2 ospA not 128-256 determined A3 ospA not 256 determined A4 ospA not 64 determined A5 ospA not 64 determined B1 ospA 32 not determined B2 ospA 64-128 " B3 ospA 64 " B4 ospA 64-128 " B5 ospA 64 " ______________________________________ No inhibition was observed with the sera of the mice administered the negative control DNA. The organ culture data shown in the following Table indicates that all ten VR2210 vaccinated mice were completely free of spirochetes in all tissues examined whereas all ten negative control mice had spirochetes in their bladder and joints. Therefore, vaccination with three doses of VR2210 gives 100% protection against spirochete challenge in vivo. ______________________________________ PRESENCE OF SPIROCHETES IN CULTURED ORGANS Combined culture data for all groups. # Positive cultures/Total Immunogen Plasma Heart Bladder Joint ______________________________________ ospA 0/10 0/10 0/10 0/10 control 3/10 7/10 10/10 10/10 ______________________________________ This is a demonstration that the Borrelia DNA plasmid is effective against bacterial pathogenic targets. Immunization with VR2210 encoding OspA protects mice completely against intradermal challenge with 104 virulent spirochetes. This in vivo protection correlates with the serum IgG response measured both by antibody ELISA and by an in vitro spirochete growth inhibition assay. The ability of the inventive composition to elicit a protective response capable of inhibiting spirochete growth demonstrates that the critical immunogenic epitopes on the bacterial protein are conserved when genes encoding these proteins are expressed in mammalian cells. This is particularly interesting and surprising because native OspA contains a lipid moiety on its N-terminus which has been shown to be a crucial determinant for the immunogenicity of the recombinant protein vaccine made from E. coli. In contrast, in the DNA and expression product of the invention, the natural OspA leader sequence which contains the lipidation signal has been replaced by the human TPA leader sequence in VR2210. Since this lipidation event is part of a post-translational processing step found uniquely in prokaryotic cells, it is unlikely that the lipid moiety is present on the VR2210 protein product. And thus, the results obtained by the present invention are indeed surprising and unexpected. This Example also demonstrates that plasmids encoding OspB, such as VR2211, or another Borrelia antigen, e.g., OspC, or encoding multiple Borrelia antigens, e.g., OspA and OspB and/or OspC, is within the scope of the invention, and are useful. For instance, this Example demonstrates that the inventive Borrelia burgdorferi antigen DNA composition of the invention is useful for eliciting antibodies which have in vivo and in vitro uses (e.g., protective response; diagnostic, detection or assay purposes). Example 5 Nucleic Acid Immunization Immunization of mice 6-10 week old female C3H/HeN mice (Harlan Laboratories, IN) were immunized with plasmid VR2210 or VR1020 (control) diluted in sterile standard saline using a collared 28 G 1/2" (12.7 mm) nedle. 50 .mu.g of plasmid was administered intra-muscularly into the rectus femoris muscle of each leg in a volume of 0.05 ml composition. Mice were boosted with identical composition on day 14 and day 28. Challenge with infectious Borrelia burgdorferi 13 days following the second boost, mice were challenged with Borrelia burgdorferi Sh-2-82 (Erdile et al., 1993). 10.sup.4 B. burgdorferi Sh-2-82 in 10% v/v BSKII in PBS (pH 7.4) were injected intra-dermally at the base of the tail. This inoculum is 100 times the ID.sub.50 for this strain of B. burdorferi (Erdile et al., 1993). Mice were sacrificed 10 days following challenge. Bladder, heart and cross-cuttings of tibiotarsal joints were aseptically removed and were placed in 6 ml BSKII containing antibiotics. Cultures were incubated at 34.degree. C. After 15 days, organ cultures were examined by phase contrast microscopy for the presence of spirochaetes. Cultures were considered negative if no spirochaetes were seen in 20 high power fields. ELISA Wet, whole cell ELISAs were carried out as previously described (Sadziene et al., 1991) using high passage B. burgdorferi B31, strain B311 (Sadziene et al., 1995) as the antigen. Serial dilutions of mouse sera were made in 1% w/v dried non-fat milk in PBS (pH 7.4). Secondary antibody was goat anti-mouse IgG+IgM+IgA (H+L) conjugated to alkaline phosphatase (Zymed Laboratories, CA) used at a dilution of 1:1000 in PBS/1% milk. Plates were developed as previously described (Sadziene et al., 1991). Absorbance was read at 490 nm on a Dynatech 580 plate reader. Samples were considered positive if the absorbance value was greater than the mean +3 standard deviations of the mean of that for non-immune and control sera (Burkot et al., 1994). In vitro growth inhibition assays Growth inhibitory titers (GI titers) of the sera from the immunized mice were determined as previously described by Sadziene et al., 1993). Two (2) hemolytic units of unheated guinea pig complement (Calbiochem, CA) was added to each of the wells of the microtiter plate to give a final concentration of 10HU.ml.sup.-1 of medium after the addition of antibody. Wells were monitored visually for changes in the color of the phenol red indicator in the medium and by phase contrast microscopy of set mounts of well contents. The GI titer was defined as the lowest dilution of antiserum that resulted in pink instead of yellow wells and represented at least 20-fold fewer cells than in wells with no serum added. PAGE and immunoblotting PAGE and immunoblot were carried out as described previously (Sadziene et al., 1995). Twenty four micrograms of recombinant lipidated OspA (see Erdile et al., 1993, U.S. Ser. No. 08/373,455) or B. burgdorferi B31 were run on preparative polyacrylamide gels and were then transferred onto nitrocellulose membranes. Immunoblots were dried and stored at 4.degree. C. until needed. Immunization of mice with VR2210 resulted in an OspA-specific antibody response Immunoblot of sera from the mice showed that those that received the plasmid bearing the B. burgdorferi B31 ospA gene, VR2210, developed an OspA-specific antibody response (FIG. 19). ELISA of the sera also showed that these mice had mounted a significant antibody response against B31. The geometric mean reciprocal ELISA titers are given in the following Table. The sera from the mice that received the plasmid with no Borrelia gene inserted, VR 1020, did not demonstrate an antibody response to B. burgdorferi. The sera from the VR2210-immunized mice were also found to inhibit growth of B. burgdorferi in vitro, to the same level as sera known to be protective. The geometric mean reciprocal GI titers of the sera are also given in the following Table. The Table also shows the reciprocal geometric mean ELISA titers of the sera from the VR2210-immunized mice when IP- 90 (B. garinii) and ACA-I (B. afzelli) were used as antigen (sera are from the bleed taken 2 days before challenge). Challenge with infectious B. burgdorferi The results of the challenge of the DNA-immunized mice with B. burgdorferi Sh-2-82 are shown in the following Table. All mice which received VR2210 were protected against challenge, whereas Borrelias were recovered from all the mice that received the VR1020 plasmid. Table Reciprocal geometric mean ELISA titers and GI titers and results of infectious challenge of mice immunized with DNA constructs VR2210 and VR1020. ______________________________________ ELISA TITER GI CULTURE Immunogen B31 IP-90 ACA-I TITER POSITIVE* ______________________________________ VR2210 54,696 2941 2389 388 0/10 (ospA) VR1020 .sup. .ltoreq.20 .ltoreq.20 .ltoreq.20 .ltoreq.8 10/10 (no insert) ______________________________________ *Culture positive at one or more sites. The results in this Table show that the invention is applicable to genospecies burgdorferi, garinii and afzelli; and need not be limited to burgdorferi or B31. FIG. 19 is an immunoblot of Borrelia burgdorferi rOspA probed with sera from mice immunized with either plasmid VR2210 (ospA) or VR1020. Sera were diluted 1:100. The positive control (+) was H5332 (anti-OspA) monoclonal hybridoma supernatant, diluted 1:10. The immunization was repeated with the plasmid construct VR2211, containing the ospB of Borrelia burgdorferi B31. An additional boost of this plasmid was given two weeks after the second boost. The 5 mice that received this construct, along with three mice that received VR1020, were challenged, and are sacrificed later. OspB-specific antibodies in sera from the VR2211 (ospB) immunized mice were detected on Western blots. Also, the VR2210 immunization was repeated, along with rOspA lipoprotein controls (immunized subcutaneously or intra-muscularly with 1 .mu.g) (5 mice per group) and the mice are bled every 2 weeks to assess the duration of the immune response to OspA by ELISA and growth inhibition assay. The results parallel those provided above. This Example demonstrates that Borrelia antigen DNA compositions of the invention are useful for eliciting an in vivo response, which response can be protective against infection (and ergo against Lyme Disease); and, that the compositions of the invention are useful for merely eliciting antibodies, which by themselves are useful (e.g., for diagnostic, detection or assay purposes). Having thus described in detail preferred embodiments of the present invention, it is to be understood that the invention defined by the appended claims is not to be limited by particular details set forth in the above description as many apparent variations thereof are possible without departing from the spirit or scope thereof. REFERENCES 1. Barbour, A. G. and Fish, D. The biological and social phenomenon of Lyme Disease. Science. 1993, 260, 1610-1616. 2. Fikrig, E., Barthold, S. W., Kantor, F. S. and Flavell, R. A. Protection of mice against the Lyme disease agent by immunizing with recombinant OspA. Science. 1990, 250, 553-556. 3. Erdile, L. f., Brandt, M., Warakomski, D. J., Westrack, G. J., Sadziene, A., Barbour, A. G. and Mays, J. P. Role of attached lipid in immunogenicity of Borrelia burgdorferi OspA. Infect. Immun. 1993, 61, 81-90. See also U.S. Ser. No. 08/373,455. 4. Keller, D., Kister, F. T., Marks, D. H., Hosback, P., Erdile, L. F. and Mays, J. P. Safety and immunogenicity of a recombinant outer surface protein A Lyme vaccine. J. Am. Med. Assoc. 1994, 271, 1764. 5. Sadziene, A., Thomas, D. D., Bundoc, V. G., Holt, S. H., and Barbour, A. G. A flagella-less mutant of Borrelia burgdorferi. J. Clin. Invest. 1991, 88, 82-92. 6. Sadziene, A., Thomas, D. D., and Barbour, A. G. Borrelia burgdorferi mutant lacing Osp: biological and immunological characterization. Infect. Immun. 1995, 63, 1573-1580. 7. Burkot, T. R., Piesman, J., and Wirtz, R. A. Quantitation of the Borrelia burgdorferi outer surface protein A in Ixodes scapularis: fluctuations during the tick life cycle, doubling times, and loss while feeding. J. Infect. Dis. 1994, 170, 883-889. 8. Sadziene, A., Thompson, P. A., and Barbour, A. G. In vitro inhibition of Borrelia burgdorferi growth by antibodies. J. Infect. Dis. 1993, 167, 165-172. 9. Bergstrom, S., Bundoc V. G., and Barbour, A. G. (1989). Molecular analysis of linear plasmid-encoded major surface proteins OspA and OspB, of the Lyme disease spirochaete Borrelia burgdorferi. Mol. Microbiol. 3:479-486. __________________________________________________________________________ SEQUENCE LISTING (1) GENERAL INFORMATION: (iii) NUMBER OF SEQUENCES: 4 (2) INFORMATION FOR SEQ ID NO:1: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 5900 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (xi) SEQUENCE DESCRIPTION: SEQ ID NO:1: CTATATACTACATCGTATCGTCATAGATACGGTTACTCGTGTGTACTTATAAGATGGCCA60 TTGCATACGTTGTATCCATATCATAATATGTACATTTATATTGGCTCATGTCCAACATTA120 CCGCCATGTTGACATTGATTATTGACTAGTTATTAATAGTAATCAATTACGGGGTCATTA180 GTTCATAGCCCATATATGGAGTTCCGCGTTACATAACTTACGGTAAATGGCCCGCCTGGC240 TGACCGCCCAACGACCCCCGCCCATTGACGTCAATAATGACGTATGTTCCCATAGTAACG300 CCAATAGGGACTTTCCATTGACGTCAATGGGTGGAGTATTTACGGTAAACTGCCCACTTG360 GCAGTACATCAAGTGTATCATATGCCAAGTACGCCCCCTATTGACGTCAATGACGGTAAA420 TGGCCCGCCTGGCATTATGCCCAGTACATGACCTTATGGGACTTTCCTACTTGGCAGTAC480 ATCTACGTATTAGTCATCGCTATTACCATGGTGATGCGGTTTTGGCAGTACATCAATGGG540 CGTGGATAGCGGTTTGACTCACGGGGATTTCCAAGTCTCCACCCCATTGACGTCAATGGG600 AGTTTGTTTTGGCACCAAAATCAACGGGACTTTCCAAAATGTCGTAACAACTCCGCCCCA660 TTGACGCAAATGGGCGGTAGGCGTGTACGGTGGGAGGTCTATATAAGCAGAGCTCGTTTA720 GTGAACCGTCAGATCGCCTGGAGACGCCATCCACGCTGTTTTGACCTCCATAGAAGACAC780 CGGGACCGATCCAGCCTCCGCGGCCGGGAACGGTGCATTGGAACGCGGATTCCCCGTGCC840 AAGAGTGACGTAAGTACCGCCTATAGAGTCTATAGGCCCACCCCCTTGGCTTCTTATGCA900 TGCTATACTGTTTTTGGCTTGGGGTCTATACACCCCCGCTTCCTCATGTTATAGGTGATG960 GTATAGCTTAGCCTATAGGTGTGGGTTATTGACCATTATTGACCACTCCCCTATTGGTGA1020 CGATACTTTCCATTACTAATCCATAACATGGCTCTTTGCCACAACTCTCTTTATTGGCTA1080 TATGCCAATACACTGTCCTTCAGAGACTGACACGGACTCTGTATTTTTACAGGATGGGGT1140 CTCATTTATTATTTACAAATTCACATATACAACACCACCGTCCCCAGTGCCCGCAGTTTT1200 TATTAAACATAACGTGGGATCTCCACGCGAATCTCGGGTACGTGTTCCGGACATGGGCTC1260 TTCTCCGGTAGCGGCGGAGCTTCTACATCCGAGCCCTGCTCCCATGCCTCCAGCGACTCA1320 TGGTCGCTCGGCAGCTCCTTGCTCCTAACAGTGGAGGCCAGACTTAGGCACAGCACGATG1380 CCCACCACCACCAGTGTGCCGCACAAGGCCGTGGCGGTAGGGTATGTGTCTGAAAATGAG1440 CTCGGGGAGCGGGCTTGCACCGCTGACGCATTTGGAAGACTTAAGGCAGCGGCAGAAGAA1500 GATGCAGGCAGCTGAGTTGTTGTGTTCTGATAAGAGTCAGAGGTAACTCCCGTTGCGGTG1560 CTGTTAACGGTGGAGGGCAGTGTAGTCTGAGCAGTACTCGTTGCTGCCGCGCGCGCCACC1620 AGACATAATAGCTGACAGACTAACAGACTGTTCCTTTCCATGGGTCTTTTCTGCAGTCAC1680 CGTCGTCGACCAGAGCTGAGATCCTACAGGAGTCCAGGGCTGGAGAGAAAACCTCTGCGA1740 GGAAAGGGAAGGAGCAAGCCGTGAATTTAAGGGACGCTGTGAAGCAATCATGGATGCAAT1800 GAAGAGAGGGCTCTGCTGTGTGCTGCTGCTGTGTGGAGCAGTCTTCGTTTCGCCCAGCGG1860 TACCTGTAAGCAAAATGTTAGCAGCCTTGACGAGAAAAACAGCGTTTCAGTAGATTTGCC1920 TGGTGAAATGAAAGTTCTTGTAAGCAAAGAAAAAAACAAAGACGGCAAGTACGATCTAAT1980 TGCAACAGTAGACAAGCTTGAGCTTAAAGGAACTTCTGATAAAAACAATGGATCTGGAGT2040 ACTTGAAGGCGTAAAAGCTGACAAAAGTAAAGTAAAATTAACAATTTCTGACGATCTAGG2100 TCAAACCACACTTGAAGTTTTCAAAGAAGATGGCAAAACACTAGTATCAAAAAAAGTAAC2160 TTCCAAAGACAAGTCATCAACAGAAGAAAAATTCAATGAAAAAGGTGAAGTATCTGAAAA2220 AATAATAACAAGAGCAGACGGAACCAGACTTGAATACACAGAAATTAAAAGCGATGGATC2280 TGGAAAAGCTAAAGAGGTTTTAAAAGGCTATGTTCTTGAAGGAACTCTAACTGCTGAAAA2340 AACAACATTGGTGGTTAAAGAAGGAACTGTTACTTTAAGCAAAAATATTTCAAAATCTGG2400 GGAAGTTTCAGTTGAACTTAATGACACTGACAGTAGTGCTGCTACTAAAAAAACTGCAGC2460 TTGGAATTCAGGCACTTCAACTTTAACAATTACTGTAAACAGTAAAAAAACTAAAGACCT2520 TGTGTTTACAAAAGAAAACACAATTACAGTACAACAATACGACTCAAATGGCACCAAATT2580 AGAGGGGTCAGCAGTTGAAATTACAAAACTTGATGAAATTAAAAACGCTCTTAAGTAAGG2640 AGAATTTTCTAGACCAGGCGCCTGGATCCAGATCTGCTGTGCCTTCTAGTTGCCAGCCAT2700 CTGTTGTTTGCCCCTCCCCCGTGCCTTCCTTGACCCTGGAAGGTGCCACTCCCACTGTCC2760 TTTCCTAATAAAATGAGGAAATTGCATCGCATTGTCTGAGTAGGTGTCATTCTATTCTGG2820 GGGGTGGGGTGGGGCAGCACAGCAAGGGGGAGGATTGGGAAGACAATAGCAGGCATGCTG2880 GGGATGCGGTGGGCTCTATGGGTACCCAGGTGCTGAAGAATTGACCCGGTTCCTCCTGGG2940 CCAGAAAGAAGCAGGCACATCCCCTTCTCTGTGACACACCCTGTCCACGCCCCTGGTTCT3000 TAGTTCCAGCCCCACTCATAGGACACTCATAGCTCAGGAGGGCTCCGCCTTCAATCCCAC3060 CCGCTAAAGTACTTGGAGCGGTCTCTCCCTCCCTCATCAGCCCACCAAACCAAACCTAGC3120 CTCCAAGAGTGGGAAGAAATTAAAGCAAGATAGGCTATTAAGTGCAGAGGGAGAGAAAAT3180 GCCTCCAACATGTGAGGAAGTAATGAGAGAAATCATAGAATTTCTTCCGCTTCCTCGCTC3240 ACTGACTCGCTGCGCTCGGTCGTTCGGCTGCGGCGAGCGGTATCAGCTCACTCAAAGGCG3300 GTAATACGGTTATCCACAGAATCAGGGGATAACGCAGGAAAGAACATGTGAGCAAAAGGC3360 CAGCAAAAGGCCAGGAACCGTAAAAAGGCCGCGTTGCTGGCGTTTTTCCATAGGCTCCGC3420 CCCCCTGACGAGCATCACAAAAATCGACGCTCAAGTCAGAGGTGGCGAAACCCGACAGGA3480 CTATAAAGATACCAGGCGTTTCCCCCTGGAAGCTCCCTCGTGCGCTCTCCTGTTCCGACC3540 CTGCCGCTTACCGGATACCTGTCCGCCTTTCTCCCTTCGGGAAGCGTGGCGCTTTCTCAA3600 TGCTCACGCTGTAGGTATCTCAGTTCGGTGTAGGTCGTTCGCTCCAAGCTGGGCTGTGTG3660 CACGAACCCCCCGTTCAGCCCGACCGCTGCGCCTTATCCGGTAACTATCGTCTTGAGTCC3720 AACCCGGTAAGACACGACTTATCGCCACTGGCAGCAGCCACTGGTAACAGGATTAGCAGA3780 GCGAGGTATGTAGGCGGTGCTACAGAGTTCTTGAAGTGGTGGCCTAACTACGGCTACACT3840 AGAAGGACAGTATTTGGTATCTGCGCTCTGCTGAAGCCAGTTACCTTCGGAAAAAGAGTT3900 GGTAGCTCTTGATCCGGCAAACAAACCACCGCTGGTAGCGGTGGTTTTTTTGTTTGCAAG3960 CAGCAGATTACGCGCAGAAAAAAAGGATCTCAAGAAGATCCTTTGATCTTTTCTACGGGG4020 TCTGACGCTCAGTGGAACGAAAACTCACGTTAAGGGATTTTGGTCATGAGATTATCAAAA4080 AGGATCTTCACCTAGATCCTTTTAAATTAAAAATGAAGTTTTAAATCAATCTAAAGTATA4140 TATGAGTAAACTTGGTCTGACAGTTACCAATGCTTAATCAGTGAGGCACCTATCTCAGCG4200 ATCTGTCTATTTCGTTCATCCATAGTTGCCTGACTCCGGGGGGGGGGGGCGCTGAGGTCT4260 GCCTCGTGAAGAAGGTGTTGCTGACTCATACCAGGCCTGAATCGCCCCATCATCCAGCCA4320 GAAAGTGAGGGAGCCACGGTTGATGAGAGCTTTGTTGTAGGTGGACCAGTTGGTGATTTT4380 GAACTTTTGCTTTGCCACGGAACGGTCTGCGTTGTCGGGAAGATGCGTGATCTGATCCTT4440 CAACTCAGCAAAAGTTCGATTTATTCAACAAAGCCGCCGTCCCGTCAAGTCAGCGTAATG4500 CTCTGCCAGTGTTACAACCAATTAACCAATTCTGATTAGAAAAACTCATCGAGCATCAAA4560 TGAAACTGCAATTTATTCATATCAGGATTATCAATACCATATTTTTGAAAAAGCCGTTTC4620 TGTAATGAAGGAGAAAACTCACCGAGGCAGTTCCATAGGATGGCAAGATCCTGGTATCGG4680 TCTGCGATTCCGACTCGTCCAACATCAATACAACCTATTAATTTCCCCTCGTCAAAAATA4740 AGGTTATCAAGTGAGAAATCACCATGAGTGACGACTGAATCCGGTGAGAATGGCAAAAGC4800 TTATGCATTTCTTTCCAGACTTGTTCAACAGGCCAGCCATTACGCTCGTCATCAAAATCA4860 CTCGCATCAACCAAACCGTTATTCATTCGTGATTGCGCCTGAGCGAGACGAAATACGCGA4920 TCGCTGTTAAAAGGACAATTACAAACAGGAATCGAATGCAACCGGCGCAGGAACACTGCC4980 AGCGCATCAACAATATTTTCACCTGAATCAGGATATTCTTCTAATACCTGGAATGCTGTT5040 TTCCCGGGGATCGCAGTGGTGAGTAACCATGCATCATCAGGAGTACGGATAAAATGCTTG5100 ATGGTCGGAAGAGGCATAAATTCCGTCAGCCAGTTTAGTCTGACCATCTCATCTGTAACA5160 TCATTGGCAACGCTACCTTTGCCATGTTTCAGAAACAACTCTGGCGCATCGGGCTTCCCA5220 TACAATCGATAGATTGTCGCACCTGATTGCCCGACATTATCGCGAGCCCATTTATACCCA5280 TATAAATCAGCATCCATGTTGGAATTTAATCGCGGCCTCGAGCAAGACGTTTCCCGTTGA5340 ATATGGCTCATAACACCCCTTGTATTACTGTTTATGTAAGCAGACAGTTTTATTGTTCAT5400 GATGATATATTTTTATCTTGTGCAATGTAACATCAGAGATTTTGAGACACAACGTGGCTT5460 TCCCCCCCCCCCCATTATTGAAGCATTTATCAGGGTTATTGTCTCATGAGCGGATACATA5520 TTTGAATGTATTTAGAAAAATAAACAAATAGGGGTTCCGCGCACATTTCCCCGAAAAGTG5580 CCACCTGACGTCTAAGAAACCATTATTATCATGACATTAACCTATAAAAATAGGCGTATC5640 ACGAGGCCCTTTCGTCTCGCGCGTTTCGGTGATGACGGTGAAAACCTCTGACACATGCAG5700 CTCCCGGAGACGGTCACAGCTTGTCTGTAAGCGGATGCCGGGAGCAGACAAGCCCGTCAG5760 GGCGCGTCAGCGGGTGTTGGCGGGTGTCGGGGCTGGCTTAACTATGCGGCATCAGAGCAG5820 ATTGTACTGAGAGTGCACCATATGCGGTGTGAAATACCGCACAGATGCGTAAGGAGAAAA5880 TACCGCATCAGATTGGCTAT5900 (2) INFORMATION FOR SEQ ID NO:2: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 5952 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (xi) SEQUENCE DESCRIPTION: SEQ ID NO:2: CTATATACTACATCGTATCGTCATAGATCGGTTACTCGTGTGTACTTATAAGATGGCCAT60 TGCATACGTTGTATCCATATCATAATATGTACATTTATATTGGCTCATGTCCAACATTAC120 CGCCATGTTGACATTGATTATTGACTAGTTATTAATAGTAATCAATTACGGGGTCATTAG180 TTCATAGCCCATATATGGAGTTCCGCGTTACATAACTTACGGTAAATGGCCCGCCTGGCT240 GACCGCCCAACGACCCCCGCCCATTGACGTCAATAATGACGTATGTTCCCATAGTAACGC300 CAATAGGGACTTTCCATTGACGTCAATGGGTGGAGTATTTACGGTAAACTGCCCACTTGG360 CAGTACATCAAGTGTATCATATGCCAAGTACGCCCCCTATTGACGTCAATGACGGTAAAT420 GGCCCGCCTGGCATTATGCCCAGTACATGACCTTATGGGACTTTCCTACTTGGCAGTACA480 TCTACGTATTAGTCATCGCTATTACCATGGTGATGCGGTTTTGGCAGTACATCAATGGGC540 GTGGATAGCGGTTTGACTCACGGGGATTTCCAAGTCTCCACCCCATTGACGTCAATGGGA600 GTTTGTTTTGGCACCAAAATCAACGGGACTTTCCAAAATGTCGTAACAACTCCGCCCCAT660 TGACGCAAATGGGCGGTAGGCGTGTACGGTGGGAGGTCTATATAAGCAGAGCTCGTTTAG720 TGAACCGTCAGATCGCCTGGAGACGCCATCCACGCTGTTTTGACCTCCATAGAAGACACC780 GGGACCGATCCAGCCTCCGCGGCCGGGAACGGTGCATTGGAACGCGGATTCCCCGTGCCA840 AGAGTGACGTAAGTACCGCCTATAGAGTCTATAGGCCCACCCCCTTGGCTTCTTATGCAT900 GCTATACTGTTTTTGGCTTGGGGTCTATACACCCCCGCTTCCTCATGTTATAGGTGATGG960 TATAGCTTAGCCTATAGGTGTGGGTTATTGACCATTATTGACCACTCCCCTATTGGTGAC1020 GATACTTTCCATTACTAATCCATAACATGGCTCTTTGCCACAACTCTCTTTATTGGCTAT1080 ATGCCAATACACTGTCCTTCAGAGACTGACACGGACTCTGTATTTTTACAGGATGGGGTC1140 TCATTTATTATTTACAAATTCACATATACAACACCACCGTCCCCAGTGCCCGCAGTTTTT1200 ATTAAACATAACGTGGGATCTCCACGCGAATCTCGGGTACGTGTTCCGGACATGGGCTCT1260 TCTCCGGTAGCGGCGGAGCTTCTACATCCGAGCCCTGCTCCCATGCCTCCAGCGACTCAT1320 GGTCGCTCGGCAGCTCCTTGCTCCTAACAGTGGAGGCCAGACTTAGGCACAGCACGATGC1380 CCACCACCACCAGTGTGCCGCACAAGGCCGTGGCGGTAGGGTATGTGTCTGAAAATGAGC1440 TCGGGGAGCGGGCTTGCACCGCTGACGCATTTGGAAGACTTAAGGCAGCGGCAGAAGAAG1500 ATGCAGGCAGCTGAGTTGTTGTGTTCTGATAAGAGTCAGAGGTAACTCCCGTTGCGGTGC1560 TGTTAACGGTGGAGGGCAGTGTAGTCTGAGCAGTACTCGTTGCTGCCGCGCGCGCCACCA1620 GACATAATAGCTGACAGACTAACAGACTGTTCCTTTCCATGGGTCTTTTCTGCAGTCACC1680 GTCGTCGACCAGAGCTGAGATCCTACAGGAGTCCAGGGCTGGAGAGAAAACCTCTGCGAG1740 GAAAGGGAAGGAGCAAGCCGTGAATTTAAGGGACGCTGTGAAGCAATCATGGATGCAATG1800 AAGAGAGGGCTCTGCTGTGTGCTGCTGCTGTGTGGAGCAGTCTTCGTTTCGCCCAGCGGT1860 ACCTGTGCACAAAAAGGTGCTGAGTCAATTGGTTCTCAAAAAGAAAATGATCTAAACCTT1920 GAAGACTCTAGTAAAAAATCACATCAAAACGCTAAACAAGACCTTCCTGCGGTGACAGAA1980 GACTCAGTGTCTTTGTTTAATGGTAATAAAATTTTTGTAAGCAAAGAAAAAAATAGCTCC2040 GGCAAATATGATTTAAGAGCAACAATTGATCAGGTTGAACTTAAAGGAACTTCCGATAAA2100 AACAATGGTTCTGGAACCCTTGAAGGTTCAAAGCCTGACAAGAGTAAAGTAAAATTAACA2160 GTTTCTGCTGATTTAAACACAGTAACCTTAGAAGCATTTGATGCCAGCAACCAAAAAATT2220 TCAAGTAAAGTTACTAAAAAACAGGGGTCAATAACAGAGGAAACTCTCAAAGCTAATAAA2280 TTAGACTCAAAGAAATTAACAAGATCAAACGGAACTACACTTGAATACTCACAAATAACA2340 GATGCTGACAATGCTACAAAAGCAGTAGAAACTCTAAAAAATAGCATTAAGCTTGAAGGA2400 AGTCTTGTAGTCGGAAAAACAACAGTGGAAATTAAAGAAGGTACTGTTACTCTAAAAAGA2460 GAAATTGAAAAAGATGGAAAAGTAAAAGTCTTTTTGAATGACACTGCAGGTTCTAACAAA2520 AAAACAGGTAAATGGGAAGACAGTACTAGCACTTTAACAATTAGTGCTGACAGCAAAAAA2580 ACTAAAGATTTGGTGTTCTTAACAGATGGTACAATTACAGTACAACAATACAACACAGCT2640 GGAACCAGCCTAGAAGGATCAGCAAGTGAAATTAAAAATCTTTCAGAGCTTAAAAACGCT2700 TTAAAATAATATATAGGATCCAGATCTGCTGTGCCTTCTAGTTGCCAGCCATCTGTTGTT2760 TGCCCCTCCCCCGTGCCTTCCTTGACCCTGGAAGGTGCCACTCCCACTGTCCTTTCCTAA2820 TAAAATGAGGAAATTGCATCGCATTGTCTGAGTAGGTGTCATTCTATTCTGGGGGGTGGG2880 GTGGGGCAGCACAGCAAGGGGGAGGATTGGGAAGACAATAGCAGGCATGCTGGGGATGCG2940 GTGGGCTCTATGGGTACCCAGGTGCTGAAGAATTGACCCGGTTCCTCCTGGGCCAGAAAG3000 AAGCAGGCACATCCCCTTCTCTGTGACACACCCTGTCCACGCCCCTGGTTCTTAGTTCCA3060 GCCCCACTCATAGGACACTCATAGCTCAGGAGGGCTCCGCCTTCAATCCCACCCGCTAAA3120 GTACTTGGAGCGGTCTCTCCCTCCCTCATCAGCCCACCAAACCAAACCTAGCCTCCAAGA3180 GTGGGAAGAAATTAAAGCAAGATAGGCTATTAAGTGCAGAGGGAGAGAAAATGCCTCCAA3240 CATGTGAGGAAGTAATGAGAGAAATCATAGAATTTCTTCCGCTTCCTCGCTCACTGACTC3300 GCTGCGCTCGGTCGTTCGGCTGCGGCGAGCGGTATCAGCTCACTCAAAGGCGGTAATACG3360 GTTATCCACAGAATCAGGGGATAACGCAGGAAAGAACATGTGAGCAAAAGGCCAGCAAAA3420 GGCCAGGAACCGTAAAAAGGCCGCGTTGCTGGCGTTTTTCCATAGGCTCCGCCCCCCTGA3480 CGAGCATCACAAAAATCGACGCTCAAGTCAGAGGTGGCGAAACCCGACAGGACTATAAAG3540 ATACCAGGCGTTTCCCCCTGGAAGCTCCCTCGTGCGCTCTCCTGTTCCGACCCTGCCGCT3600 TACCGGATACCTGTCCGCCTTTCTCCCTTCGGGAAGCGTGGCGCTTTCTCAATGCTCACG3660 CTGTAGGTATCTCAGTTCGGTGTAGGTCGTTCGCTCCAAGCTGGGCTGTGTGCACGAACC3720 CCCCGTTCAGCCCGACCGCTGCGCCTTATCCGGTAACTATCGTCTTGAGTCCAACCCGGT3780 AAGACACGACTTATCGCCACTGGCAGCAGCCACTGGTAACAGGATTAGCAGAGCGAGGTA3840 TGTAGGCGGTGCTACAGAGTTCTTGAAGTGGTGGCCTAACTACGGCTACACTAGAAGGAC3900 AGTATTTGGTATCTGCGCTCTGCTGAAGCCAGTTACCTTCGGAAAAAGAGTTGGTAGCTC3960 TTGATCCGGCAAACAAACCACCGCTGGTAGCGGTGGTTTTTTTGTTTGCAAGCAGCAGAT4020 TACGCGCAGAAAAAAAGGATCTCAAGAAGATCCTTTGATCTTTTCTACGGGGTCTGACGC4080 TCAGTGGAACGAAAACTCACGTTAAGGGATTTTGGTCATGAGATTATCAAAAAGGATCTT4140 CACCTAGATCCTTTTAAATTAAAAATGAAGTTTTAAATCAATCTAAAGTATATATGAGTA4200 AACTTGGTCTGACAGTTACCAATGCTTAATCAGTGAGGCACCTATCTCAGCGATCTGTCT4260 ATTTCGTTCATCCATAGTTGCCTGACTCCGGGGGGGGGGGGCGCTGAGGTCTGCCTCGTG4320 AAGAAGGTGTTGCTGACTCATACCAGGCCTGAATCGCCCCATCATCCAGCCAGAAAGTGA4380 GGGAGCCACGGTTGATGAGAGCTTTGTTGTAGGTGGACCAGTTGGTGATTTTGAACTTTT4440 GCTTTGCCACGGAACGGTCTGCGTTGTCGGGAAGATGCGTGATCTGATCCTTCAACTCAG4500 CAAAAGTTCGATTTATTCAACAAAGCCGCCGTCCCGTCAAGTCAGCGTAATGCTCTGCCA4560 GTGTTACAACCAATTAACCAATTCTGATTAGAAAAACTCATCGAGCATCAAATGAAACTG4620 CAATTTATTCATATCAGGATTATCAATACCATATTTTTGAAAAAGCCGTTTCTGTAATGA4680 AGGAGAAAACTCACCGAGGCAGTTCCATAGGATGGCAAGATCCTGGTATCGGTCTGCGAT4740 TCCGACTCGTCCAACATCAATACAACCTATTAATTTCCCCTCGTCAAAAATAAGGTTATC4800 AAGTGAGAAATCACCATGAGTGACGACTGAATCCGGTGAGAATGGCAAAAGCTTATGCAT4860 TTCTTTCCAGACTTGTTCAACAGGCCAGCCATTACGCTCGTCATCAAAATCACTCGCATC4920 AACCAAACCGTTATTCATTCGTGATTGCGCCTGAGCGAGACGAAATACGCGATCGCTGTT4980 AAAAGGACAATTACAAACAGGAATCGAATGCAACCGGCGCAGGAACACTGCCAGCGCATC5040 AACAATATTTTCACCTGAATCAGGATATTCTTCTAATACCTGGAATGCTGTTTTCCCGGG5100 GATCGCAGTGGTGAGTAACCATGCATCATCAGGAGTACGGATAAAATGCTTGATGGTCGG5160 AAGAGGCATAAATTCCGTCAGCCAGTTTAGTCTGACCATCTCATCTGTAACATCATTGGC5220 AACGCTACCTTTGCCATGTTTCAGAAACAACTCTGGCGCATCGGGCTTCCCATACAATCG5280 ATAGATTGTCGCACCTGATTGCCCGACATTATCGCGAGCCCATTTATACCCATATAAATC5340 AGCATCCATGTTGGAATTTAATCGCGGCCTCGAGCAAGACGTTTCCCGTTGAATATGGCT5400 CATAACACCCCTTGTATTACTGTTTATGTAAGCAGACAGTTTTATTGTTCATGATGATAT5460 ATTTTTATCTTGTGCAATGTAACATCAGAGATTTTGAGACACAACGTGGCTTTCCCCCCC5520 CCCCCATTATTGAAGCATTTATCAGGGTTATTGTCTCATGAGCGGATACATATTTGAATG5580 TATTTAGAAAAATAAACAAATAGGGGTTCCGCGCACATTTCCCCGAAAAGTGCCACCTGA5640 CGTCTAAGAAACCATTATTATCATGACATTAACCTATAAAAATAGGCGTATCACGAGGCC5700 CTTTCGTCTCGCGCGTTTCGGTGATGACGGTGAAAACCTCTGACACATGCAGCTCCCGGA5760 GACGGTCACAGCTTGTCTGTAAGCGGATGCCGGGAGCAGACAAGCCCGTCAGGGCGCGTC5820 AGCGGGTGTTGGCGGGTGTCGGGGCTGGCTTAACTATGCGGCATCAGAGCAGATTGTACT5880 GAGAGTGCACCATATGCGGTGTGAAATACCGCACAGATGCGTAAGGAGAAAATACCGCAT5940 CAGATTGGCTAT5952 (2) INFORMATION FOR SEQ ID NO:3: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 5676 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (xi) SEQUENCE DESCRIPTION: SEQ ID NO:3: CTATATACTACATCGTATCGTCATAGATCCGGTTACGTGTACTTATAAGATGGCCATTGC60 ATACGTTGTATCCATATCATAATATGTACATTTATATTGGCTCATGTCCAACATTACCGC120 CATGTTGACATTGATTATTGACTAGTTATTAATAGTAATCAATTACGGGGTCATTAGTTC180 ATAGCCCATATATGGAGTTCCGCGTTACATAACTTACGGTAAATGGCCCGCCTGGCTGAC240 CGCCCAACGACCCCCGCCCATTGACGTCAATAATGACGTATGTTCCCATAGTAACGCCAA300 TAGGGACTTTCCATTGACGTCAATGGGTGGAGTATTTACGGTAAACTGCCCACTTGGCAG360 TACATCAAGTGTATCATATGCCAAGTACGCCCCCTATTGACGTCAATGACGGTAAATGGC420 CCGCCTGGCATTATGCCCAGTACATGACCTTATGGGACTTTCCTACTTGGCAGTACATCT480 ACGTATTAGTCATCGCTATTACCATGGTGATGCGGTTTTGGCAGTACATCAATGGGCGTG540 GATAGCGGTTTGACTCACGGGGATTTCCAAGTCTCCACCCCATTGACGTCAATGGGAGTT600 TGTTTTGGCACCAAAATCAACGGGACTTTCCAAAATGTCGTAACAACTCCGCCCCATTGA660 CGCAAATGGGCGGTAGGCGTGTACGGTGGGAGGTCTATATAAGCAGAGCTCGTTTAGTGA720 ACCGTCAGATCGCCTGGAGACGCCATCCACGCTGTTTTGACCTCCATAGAAGACACCGGG780 ACCGATCCAGCCTCCGCGGCCGGGAACGGTGCATTGGAACGCGGATTCCCCGTGCCAAGA840 GTGACGTAAGTACCGCCTATAGAGTCTATAGGCCCACCCCCTTGGCTTCTTATGCATGCT900 ATACTGTTTTTGGCTTGGGGTCTATACACCCCCGCTTCCTCATGTTATAGGTGATGGTAT960 AGCTTAGCCTATAGGTGTGGGTTATTGACCATTATTGACCACTCCCCTATTGGTGACGAT1020 ACTTTCCATTACTAATCCATAACATGGCTCTTTGCCACAACTCTCTTTATTGGCTATATG1080 CCAATACACTGTCCTTCAGAGACTGACACGGACTCTGTATTTTTACAGGATGGGGTCTCA1140 TTTATTATTTACAAATTCACATATACAACACCACCGTCCCCAGTGCCCGCAGTTTTTATT1200 AAACATAACGTGGGATCTCCACGCGAATCTCGGGTACGTGTTCCGGACATGGGCTCTTCT1260 CCGGTAGCGGCGGAGCTTCTACATCCGAGCCCTGCTCCCATGCCTCCAGCGACTCATGGT1320 CGCTCGGCAGCTCCTTGCTCCTAACAGTGGAGGCCAGACTTAGGCACAGCACGATGCCCA1380 CCACCACCAGTGTGCCGCACAAGGCCGTGGCGGTAGGGTATGTGTCTGAAAATGAGCTCG1440 GGGAGCGGGCTTGCACCGCTGACGCATTTGGAAGACTTAAGGCAGCGGCAGAAGAAGATG1500 CAGGCAGCTGAGTTGTTGTGTTCTGATAAGAGTCAGAGGTAACTCCCGTTGCGGTGCTGT1560 TAACGGTGGAGGGCAGTGTAGTCTGAGCAGTACTCGTTGCTGCCGCGCGCGCCACCAGAC1620 ATAATAGCTGACAGACTAACAGACTGTTCCTTTCCATGGGTCTTTTCTGCAGTCACCGTC1680 GTCGACCAGAGCTGAGATCCTACAGGAGTCCAGGGCTGGAGAGAAAACCTCTGCGAGGAA1740 AGGGAAGGAGCAAGCCGTGAATTTAAGGGACGCTGTGAAGCAATCATGGATGCAATGAAG1800 AGAGGGCTCTGCTGTGTGCTGCTGCTGTGTGGAGCAGTCTTCGTTTCGCCCAGCGGTACC1860 TGTAATAATTCAGGGAAAGATGGGAATACATCTGCAAATTCTGCTGATGAGTCTGTTAAA1920 GGGCCTAATCTTACAGAAATAAGTAAAAAAATTACGGATTCTAATGCGGTTTTACTTGCT1980 GTGAAAGAGGTTGAAGCGTTGCTGTCATCTATAGATGAAATTGCTGCTAAAGCTATTGGT2040 AAAAAAATACACCAAAATAATGGTTTGGATACCGAAAATAATCACAATGGATCATTGTTA2100 GCGGGAGCTTATGCAATATCAACCCTAATAAAACAAAAATTAGATGGATTGAAAAATGAA2160 GGATTAAAGGAAAAAATTGATGCGGCTAAGAAATGTTCTGAAACATTTACTAATAAATTA2220 AAAGAAAAACACACAGATCTTGGTAAAGAAGGTGTTACTGATGCTGATGCAAAAGAAGCG2280 ATTTTAAAAACAAATGGTACTAAAACTAAAGGTGCTGAAGAACTTGGAAAATTATTTGAA2340 TCAGTAGAGGTCTTGTCAAAAGCAGCTAAAGAGATGCTTGCTAATTCAGTTAAAGAGCTT2400 ACAAGCCCTGTTGTGGCAGAAAGTCCAAAAAAACCTTAAGGATCCAGATCTGCTGTGCCT2460 TCTAGTTGCCAGCCATCTGTTGTTTGCCCCTCCCCCGTGCCTTCCTTGACCCTGGAAGGT2520 GCCACTCCCACTGTCCTTTCCTAATAAAATGAGGAAATTGCATCGCATTGTCTGAGTAGG2580 TGTCATTCTATTCTGGGGGGTGGGGTGGGGCAGCACAGCAAGGGGGAGGATTGGGAAGAC2640 AATAGCAGGCATGCTGGGGATGCGGTGGGCTCTATGGGGACCCAGGTGCTGAAGAATTGA2700 CCCGGTTCCTCCTGGGCCAGAAAGAAGCAGGCACATCCCCTTCTCTGTGACACACCCTGT2760 CCACGCCCCTGGTTCTTAGTTCCAGCCCCACTCATAGGACACTCATAGCTCAGGAGGGCT2820 CCGCCTTCAATCCCACCCGCTAAAGTACTTGGAGCGGTCTCTCCCTCCCTCATCAGCCCA2880 CCAAACCAAACCTAGCCTCCAAGAGTGGGAAGAAATTAAAGCAAGATAGGCTATTAAGTG2940 CAGAGGGAGAGAAAATGCCTCCAACATGTGAGGAAGTAATGAGAGAAATCATAGAATTTC3000 TTCCGCTTCCTCGCTCACTGACTCGCTGCGCTCGGTCGTTCGGCTGCGGCGAGCGGTATC3060 AGCTCACTCAAAGGCGGTAATACGGTTATCCACAGAATCAGGGGATAACGCAGGAAAGAA3120 CATGTGAGCAAAAGGCCAGCAAAAGGCCAGGAACCGTAAAAAGGCCGCGTTGCTGGCGTT3180 TTTCCATAGGCTCCGCCCCCCTGACGAGCATCACAAAAATCGACGCTCAAGTCAGAGGTG3240 GCGAAACCCGACAGGACTATAAAGATACCAGGCGTTTCCCCCTGGAAGCTCCCTCGTGCG3300 CTCTCCTGTTCCGACCCTGCCGCTTACCGGATACCTGTCCGCCTTTCTCCCTTCGGGAAG3360 CGTGGCGCTTTCTCAATGCTCACGCTGTAGGTATCTCAGTTCGGTGTAGGTCGTTCGCTC3420 CAAGCTGGGCTGTGTGCACGAACCCCCCGTTCAGCCCGACCGCTGCGCCTTATCCGGTAA3480 CTATCGTCTTGAGTCCAACCCGGTAAGACACGACTTATCGCCACTGGCAGCAGCCACTGG3540 TAACAGGATTAGCAGAGCGAGGTATGTAGGCGGTGCTACAGAGTTCTTGAAGTGGTGGCC3600 TAACTACGGCTACACTAGAAGGACAGTATTTGGTATCTGCGCTCTGCTGAAGCCAGTTAC3660 CTTCGGAAAAAGAGTTGGTAGCTCTTGATCCGGCAAACAAACCACCGCTGGTAGCGGTGG3720 TTTTTTTGTTTGCAAGCAGCAGATTACGCGCAGAAAAAAAGGATCTCAAGAAGATCCTTT3780 GATCTTTTCTACGGGGTCTGACGCTCAGTGGAACGAAAACTCACGTTAAGGGATTTTGGT3840 CATGAGATTATCAAAAAGGATCTTCACCTAGATCCTTTTAAATTAAAAATGAAGTTTTAA3900 ATCAATCTAAAGTATATATGAGTAAACTTGGTCTGACAGTTACCAATGCTTAATCAGTGA3960 GGCACCTATCTCAGCGATCTGTCTATTTCGTTCATCCATAGTTGCCTGACTCCGGGGGGG4020 GGGGGCGCTGAGGTCTGCCTCGTGAAGAAGGTGTTGCTGACTCATACCAGGCCTGAATCG4080 CCCCATCATCCAGCCAGAAAGTGAGGGAGCCACGGTTGATGAGAGCTTTGTTGTAGGTGG4140 ACCAGTTGGTGATTTTGAACTTTTGCTTTGCCACGGAACGGTCTGCGTTGTCGGGAAGAT4200 GCGTGATCTGATCCTTCAACTCAGCAAAAGTTCGATTTATTCAACAAAGCCGCCGTCCCG4260 TCAAGTCAGCGTAATGCTCTGCCAGTGTTACAACCAATTAACCAATTCTGATTAGAAAAA4320 CTCATCGAGCATCAAATGAAACTGCAATTTATTCATATCAGGATTATCAATACCATATTT4380 TTGAAAAAGCCGTTTCTGTAATGAAGGAGAAAACTCACCGAGGCAGTTCCATAGGATGGC4440 AAGATCCTGGTATCGGTCTGCGATTCCGACTCGTCCAACATCAATACAACCTATTAATTT4500 CCCCTCGTCAAAAATAAGGTTATCAAGTGAGAAATCACCATGAGTGACGACTGAATCCGG4560 TGAGAATGGCAAAAGCTTATGCATTTCTTTCCAGACTTGTTCAACAGGCCAGCCATTACG4620 CTCGTCATCAAAATCACTCGCATCAACCAAACCGTTATTCATTCGTGATTGCGCCTGAGC4680 GAGACGAAATACGCGATCGCTGTTAAAAGGACAATTACAAACAGGAATCGAATGCAACCG4740 GCGCAGGAACACTGCCAGCGCATCAACAATATTTTCACCTGAATCAGGATATTCTTCTAA4800 TACCTGGAATGCTGTTTTCCCGGGGATCGCAGTGGTGAGTAACCATGCATCATCAGGAGT4860 ACGGATAAAATGCTTGATGGTCGGAAGAGGCATAAATTCCGTCAGCCAGTTTAGTCTGAC4920 CATCTCATCTGTAACATCATTGGCAACGCTACCTTTGCCATGTTTCAGAAACAACTCTGG4980 CGCATCGGGCTTCCCATACAATCGATAGATTGTCGCACCTGATTGCCCGACATTATCGCG5040 AGCCCATTTATACCCATATAAATCAGCATCCATGTTGGAATTTAATCGCGGCCTAGAGCA5100 AGACGTTTCCCGTTGAATATGGCTCATAACACCCCTTGTATTACTGTTTATGTAAGCAGA5160 CAGTTTTATTGTTCATGATGATATATTTTTATCTTGTGCAATGTAACATCAGAGATTTTG5220 AGACACAACGTGGCTTTCCCCCCCCCCCCATTATTGAAGCATTTATCAGGGTTATTGTCT5280 CATGAGCGGATACATATTTGAATGTATTTAGAAAAATAAACAAATAGGGGTTCCGCGCAC5340 ATTTCCCCGAAAAGTGCCACCTGACGTCTAAGAAACCATTATTATCATGACATTAACCTA5400 TAAAAATAGGCGTATCACGAGGCCCTTTCGTCTCGCGCGTTTCGGTGATGACGGTGAAAA5460 CCTCTGACACATGCAGCTCCCGGAGACGGTCACAGCTTGTCTGTAAGCGGATGCCGGGAG5520 CAGACAAGCCCGTCAGGGCGCGTCAGCGGGTGTTGGCGGGTGTCGGGGCTGGCTTAACTA5580 TGCGGCATCAGAGCAGATTGTACTGAGAGTGCACCATATGCGGTGTGAAATACCGCACAG5640 ATGCGTAAGGAGAAAATACCGCATCAGATTGGCTAT5676 (2) INFORMATION FOR SEQ ID NO:4: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 5682 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (xi) SEQUENCE DESCRIPTION: SEQ ID NO:4: CTATATACTACATCGTATCGTCATAGATCCGGTTACGTGTACTTATAAGATGGCCATTGC60 ATACGTTGTATCCATATCATAATATGTACATTTATATTGGCTCATGTCCAACATTACCGC120 CATGTTGACATTGATTATTGACTAGTTATTAATAGTAATCAATTACGGGGTCATTAGTTC180 ATAGCCCATATATGGAGTTCCGCGTTACATAACTTACGGTAAATGGCCCGCCTGGCTGAC240 CGCCCAACGACCCCCGCCCATTGACGTCAATAATGACGTATGTTCCCATAGTAACGCCAA300 TAGGGACTTTCCATTGACGTCAATGGGTGGAGTATTTACGGTAAACTGCCCACTTGGCAG360 TACATCAAGTGTATCATATGCCAAGTACGCCCCCTATTGACGTCAATGACGGTAAATGGC420 CCGCCTGGCATTATGCCCAGTACATGACCTTATGGGACTTTCCTACTTGGCAGTACATCT480 ACGTATTAGTCATCGCTATTACCATGGTGATGCGGTTTTGGCAGTACATCAATGGGCGTG540 GATAGCGGTTTGACTCACGGGGATTTCCAAGTCTCCACCCCATTGACGTCAATGGGAGTT600 TGTTTTGGCACCAAAATCAACGGGACTTTCCAAAATGTCGTAACAACTCCGCCCCATTGA660 CGCAAATGGGCGGTAGGCGTGTACGGTGGGAGGTCTATATAAGCAGAGCTCGTTTAGTGA720 ACCGTCAGATCGCCTGGAGACGCCATCCACGCTGTTTTGACCTCCATAGAAGACACCGGG780 ACCGATCCAGCCTCCGCGGCCGGGAACGGTGCATTGGAACGCGGATTCCCCGTGCCAAGA840 GTGACGTAAGTACCGCCTATAGAGTCTATAGGCCCACCCCCTTGGCTTCTTATGCATGCT900 ATACTGTTTTTGGCTTGGGGTCTATACACCCCCGCTTCCTCATGTTATAGGTGATGGTAT960 AGCTTAGCCTATAGGTGTGGGTTATTGACCATTATTGACCACTCCCCTATTGGTGACGAT1020 ACTTTCCATTACTAATCCATAACATGGCTCTTTGCCACAACTCTCTTTATTGGCTATATG1080 CCAATACACTGTCCTTCAGAGACTGACACGGACTCTGTATTTTTACAGGATGGGGTCTCA1140 TTTATTATTTACAAATTCACATATACAACACCACCGTCCCCAGTGCCCGCAGTTTTTATT1200 AAACATAACGTGGGATCTCCACGCGAATCTCGGGTACGTGTTCCGGACATGGGCTCTTCT1260 CCGGTAGCGGCGGAGCTTCTACATCCGAGCCCTGCTCCCATGCCTCCAGCGACTCATGGT1320 CGCTCGGCAGCTCCTTGCTCCTAACAGTGGAGGCCAGACTTAGGCACAGCACGATGCCCA1380 CCACCACCAGTGTGCCGCACAAGGCCGTGGCGGTAGGGTATGTGTCTGAAAATGAGCTCG1440 GGGAGCGGGCTTGCACCGCTGACGCATTTGGAAGACTTAAGGCAGCGGCAGAAGAAGATG1500 CAGGCAGCTGAGTTGTTGTGTTCTGATAAGAGTCAGAGGTAACTCCCGTTGCGGTGCTGT1560 TAACGGTGGAGGGCAGTGTAGTCTGAGCAGTACTCGTTGCTGCCGCGCGCGCCACCAGAC1620 ATAATAGCTGACAGACTAACAGACTGTTCCTTTCCATGGGTCTTTTCTGCAGTCACCGTC1680 GTCGACCAGAGCTGAGATCCTACAGGAGTCCAGGGCTGGAGAGAAAACCTCTGCGAGGAA1740 AGGGAAGGAGCAAGCCGTGAATTTAAGGGACGCTGTGAAGCAATCATGGATGCAATGAAG1800 AGAGGGCTCTGCTGTGTGCTGCTGCTGTGTGGAGCAGTCTTCGTTTCGCCCAGCGGTACC1860 TGTAATAATTCAGGGAAAGGTGGGGATTCTGCATCTACTAATCCTGCTGACGAGTCTGCG1920 AAAGGGCCTAATCTTACAGAAATAAGCAAAAAAATTACAGATTCTAATGCATTTGTACTT1980 GCTGTTAAAGAAGTTGAGACTTTGGTTTTATCTATAGATGAACTTGCTAAGAAAGCTATA2040 GGTCAAAAAATAGACAATAATAATGGTTTAGCTGCTTTAAATAATCAGAATGGATCGTTG2100 TTAGCAGGAGCCTATGCAATATCAACCCTAATAACAGAAAAATTGAGTAAATTGAAAAAT2160 TTAGAAGAATTAAAGACAGAAATTGCAAAGGCTAAGAAATGTTCCGAAGAATTTACTAAT2220 AAACTAAAAAGTGGTCATGCAGATCTTGGCAAACAGGATGCTACCGATGATCATGCAAAA2280 GCAGCTATTTTAAAAACACATGCAACTACCGATAAAGGTGCTAAAGAATTTAAAGATTTA2340 TTTGAATCAGTAGAAGGTTTGTTAAAAGCAGCTCAAGTAGCACTAACTAATTCAGTTAAA2400 GAACTTACAAGTCCTGTTGTAGCAGAAAGTCCAAAAAAACCTTAAGGATCCAGATCTGCT2460 GTGCCTTCTAGTTGCCAGCCATCTGTTGTTTGCCCCTCCCCCGTGCCTTCCTTGACCCTG2520 GAAGGTGCCACTCCCACTGTCCTTTCCTAATAAAATGAGGAAATTGCATCGCATTGTCTG2580 AGTAGGTGTCATTCTATTCTGGGGGGTGGGGTGGGGCAGCACAGCAAGGGGGAGGATTGG2640 GAAGACAATAGCAGGCATGCTGGGGATGCGGTGGGCTCTATGGGGACCCAGGTGCTGAAG2700 AATTGACCCGGTTCCTCCTGGGCCAGAAAGAAGCAGGCACATCCCCTTCTCTGTGACACA2760 CCCTGTCCACGCCCCTGGTTCTTAGTTCCAGCCCCACTCATAGGACACTCATAGCTCAGG2820 AGGGCTCCGCCTTCAATCCCACCCGCTAAAGTACTTGGAGCGGTCTCTCCCTCCCTCATC2880 AGCCCACCAAACCAAACCTAGCCTCCAAGAGTGGGAAGAAATTAAAGCAAGATAGGCTAT2940 TAAGTGCAGAGGGAGAGAAAATGCCTCCAACATGTGAGGAAGTAATGAGAGAAATCATAG3000 AATTTCTTCCGCTTCCTCGCTCACTGACTCGCTGCGCTCGGTCGTTCGGCTGCGGCGAGC3060 GGTATCAGCTCACTCAAAGGCGGTAATACGGTTATCCACAGAATCAGGGGATAACGCAGG3120 AAAGAACATGTGAGCAAAAGGCCAGCAAAAGGCCAGGAACCGTAAAAAGGCCGCGTTGCT3180 GGCGTTTTTCCATAGGCTCCGCCCCCCTGACGAGCATCACAAAAATCGACGCTCAAGTCA3240 GAGGTGGCGAAACCCGACAGGACTATAAAGATACCAGGCGTTTCCCCCTGGAAGCTCCCT3300 CGTGCGCTCTCCTGTTCCGACCCTGCCGCTTACCGGATACCTGTCCGCCTTTCTCCCTTC3360 GGGAAGCGTGGCGCTTTCTCAATGCTCACGCTGTAGGTATCTCAGTTCGGTGTAGGTCGT3420 TCGCTCCAAGCTGGGCTGTGTGCACGAACCCCCCGTTCAGCCCGACCGCTGCGCCTTATC3480 CGGTAACTATCGTCTTGAGTCCAACCCGGTAAGACACGACTTATCGCCACTGGCAGCAGC3540 CACTGGTAACAGGATTAGCAGAGCGAGGTATGTAGGCGGTGCTACAGAGTTCTTGAAGTG3600 GTGGCCTAACTACGGCTACACTAGAAGGACAGTATTTGGTATCTGCGCTCTGCTGAAGCC3660 AGTTACCTTCGGAAAAAGAGTTGGTAGCTCTTGATCCGGCAAACAAACCACCGCTGGTAG3720 CGGTGGTTTTTTTGTTTGCAAGCAGCAGATTACGCGCAGAAAAAAAGGATCTCAAGAAGA3780 TCCTTTGATCTTTTCTACGGGGTCTGACGCTCAGTGGAACGAAAACTCACGTTAAGGGAT3840 TTTGGTCATGAGATTATCAAAAAGGATCTTCACCTAGATCCTTTTAAATTAAAAATGAAG3900 TTTTAAATCAATCTAAAGTATATATGAGTAAACTTGGTCTGACAGTTACCAATGCTTAAT3960 CAGTGAGGCACCTATCTCAGCGATCTGTCTATTTCGTTCATCCATAGTTGCCTGACTCCG4020 GGGGGGGGGGGCGCTGAGGTCTGCCTCGTGAAGAAGGTGTTGCTGACTCATACCAGGCCT4080 GAATCGCCCCATCATCCAGCCAGAAAGTGAGGGAGCCACGGTTGATGAGAGCTTTGTTGT4140 AGGTGGACCAGTTGGTGATTTTGAACTTTTGCTTTGCCACGGAACGGTCTGCGTTGTCGG4200 GAAGATGCGTGATCTGATCCTTCAACTCAGCAAAAGTTCGATTTATTCAACAAAGCCGCC4260 GTCCCGTCAAGTCAGCGTAATGCTCTGCCAGTGTTACAACCAATTAACCAATTCTGATTA4320 GAAAAACTCATCGAGCATCAAATGAAACTGCAATTTATTCATATCAGGATTATCAATACC4380 ATATTTTTGAAAAAGCCGTTTCTGTAATGAAGGAGAAAACTCACCGAGGCAGTTCCATAG4440 GATGGCAAGATCCTGGTATCGGTCTGCGATTCCGACTCGTCCAACATCAATACAACCTAT4500 TAATTTCCCCTCGTCAAAAATAAGGTTATCAAGTGAGAAATCACCATGAGTGACGACTGA4560 ATCCGGTGAGAATGGCAAAAGCTTATGCATTTCTTTCCAGACTTGTTCAACAGGCCAGCC4620 ATTACGCTCGTCATCAAAATCACTCGCATCAACCAAACCGTTATTCATTCGTGATTGCGC4680 CTGAGCGAGACGAAATACGCGATCGCTGTTAAAAGGACAATTACAAACAGGAATCGAATG4740 CAACCGGCGCAGGAACACTGCCAGCGCATCAACAATATTTTCACCTGAATCAGGATATTC4800 TTCTAATACCTGGAATGCTGTTTTCCCGGGGATCGCAGTGGTGAGTAACCATGCATCATC4860 AGGAGTACGGATAAAATGCTTGATGGTCGGAAGAGGCATAAATTCCGTCAGCCAGTTTAG4920 TCTGACCATCTCATCTGTAACATCATTGGCAACGCTACCTTTGCCATGTTTCAGAAACAA4980 CTCTGGCGCATCGGGCTTCCCATACAATCGATAGATTGTCGCACCTGATTGCCCGACATT5040 ATCGCGAGCCCATTTATACCCATATAAATCAGCATCCATGTTGGAATTTAATCGCGGCCT5100 AGAGCAAGACGTTTCCCGTTGAATATGGCTCATAACACCCCTTGTATTACTGTTTATGTA5160 AGCAGACAGTTTTATTGTTCATGATGATATATTTTTATCTTGTGCAATGTAACATCAGAG5220 ATTTTGAGACACAACGTGGCTTTCCCCCCCCCCCCATTATTGAAGCATTTATCAGGGTTA5280 TTGTCTCATGAGCGGATACATATTTGAATGTATTTAGAAAAATAAACAAATAGGGGTTCC5340 GCGCACATTTCCCCGAAAAGTGCCACCTGACGTCTAAGAAACCATTATTATCATGACATT5400 AACCTATAAAAATAGGCGTATCACGAGGCCCTTTCGTCTCGCGCGTTTCGGTGATGACGG5460 TGAAAACCTCTGACACATGCAGCTCCCGGAGACGGTCACAGCTTGTCTGTAAGCGGATGC5520 CGGGAGCAGACAAGCCCGTCAGGGCGCGTCAGCGGGTGTTGGCGGGTGTCGGGGCTGGCT5580 TAACTATGCGGCATCAGAGCAGATTGTACTGAGAGTGCACCATATGCGGTGTGAAATACC5640 GCACAGATGCGTAAGGAGAAAATACCGCATCAGATTGGCTAT5682 __________________________________________________________________________ For U.S. patent law, rules, and procedures see MPEP. Disclaimer. Information presented on this page while believed to be reliable, is provided "as is" with no warranties of its accuracy or timeliness. For legal advice seek help of a licensed professional. |